ID: 918015747

View in Genome Browser
Species Human (GRCh38)
Location 1:180631337-180631359
Sequence GGGCCTGTTTCCGGTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918015742_918015747 2 Left 918015742 1:180631312-180631334 CCAGGGACACTTCAGCCTGGGTG 0: 1
1: 0
2: 6
3: 59
4: 669
Right 918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 72
918015736_918015747 12 Left 918015736 1:180631302-180631324 CCCATGTTCCCCAGGGACACTTC 0: 1
1: 0
2: 0
3: 19
4: 182
Right 918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 72
918015741_918015747 3 Left 918015741 1:180631311-180631333 CCCAGGGACACTTCAGCCTGGGT 0: 1
1: 0
2: 2
3: 42
4: 393
Right 918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 72
918015739_918015747 4 Left 918015739 1:180631310-180631332 CCCCAGGGACACTTCAGCCTGGG 0: 1
1: 0
2: 5
3: 33
4: 359
Right 918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 72
918015737_918015747 11 Left 918015737 1:180631303-180631325 CCATGTTCCCCAGGGACACTTCA 0: 1
1: 0
2: 0
3: 27
4: 262
Right 918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918015747 Original CRISPR GGGCCTGTTTCCGGTTTTAC TGG Intergenic
900486745 1:2926237-2926259 GGGCCTGCTTCAGGTTTTTAGGG + Intergenic
900687128 1:3955682-3955704 GGTCCAGATTCCGGTTTTATTGG - Intergenic
904673084 1:32180403-32180425 GGTCCTGCTTCCGGTTGTCCTGG - Exonic
906334073 1:44913479-44913501 GGCCCTGTTGCCTGTTTTAATGG + Intronic
915449126 1:155992571-155992593 GGGCCTGTTTTTGTTTTTAAAGG + Intronic
918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG + Intergenic
918095136 1:181328197-181328219 GGGCCTGTTTCCTGGTTCATAGG + Intergenic
918153094 1:181815485-181815507 GGGCCTGCTTCCTGGTTTGCAGG - Intergenic
920933725 1:210412033-210412055 GGGCCTGCTTCCTGGTTCACAGG + Intronic
922767995 1:228165959-228165981 GGGCCTGCTTCCGGCTGGACGGG + Exonic
1066514239 10:36138651-36138673 TGTCATGTTCCCGGTTTTACAGG + Intergenic
1073471779 10:103727077-103727099 GGGGCTGTGCCTGGTTTTACAGG + Intronic
1080621740 11:33992557-33992579 GGGCATGCTTCCTGGTTTACAGG + Intergenic
1085520604 11:77137122-77137144 GTGCCTGTTTTCGGCTTGACTGG + Intronic
1087680985 11:101218186-101218208 GGGCCTGCTTCCTGTTTCCCTGG + Intergenic
1095560954 12:43564359-43564381 GGGCCTGTTTCACATATTACAGG - Intergenic
1106697400 13:32191685-32191707 GGGCCTTTTTCCTGGTTCACAGG + Intronic
1109052378 13:57500226-57500248 GGGCCTGTTTCCTGATTCATAGG + Intergenic
1110495963 13:76168248-76168270 GGGCTTGTTTCCTGGTTTGCAGG + Intergenic
1112373831 13:98820389-98820411 GGGCCTGTTCATGGTGTTACAGG + Intronic
1117288145 14:54307274-54307296 GTTCCTTTTTCTGGTTTTACAGG - Intergenic
1124910289 15:33913653-33913675 GGGCTGGTTTTCAGTTTTACAGG - Intronic
1127798384 15:62457195-62457217 GGGCCTTCTTCCTGGTTTACAGG + Intronic
1130690019 15:86074196-86074218 GGGCCTGTTTCATGGTTCACAGG + Intergenic
1134116235 16:11550910-11550932 GCGCCTGTTTTAAGTTTTACGGG - Intronic
1136348887 16:29694564-29694586 GGGCCAGTTCCCAGTTTCACTGG + Intronic
1144125936 17:12202872-12202894 GGGCCTGTTTCCTGATTGCCAGG - Intergenic
1144340511 17:14305818-14305840 GGCACTGTTTCAAGTTTTACAGG + Intronic
1146680180 17:34801512-34801534 AGGCCAGGTTCCGGTTCTACAGG - Intergenic
1157585391 18:48797753-48797775 CTGCCTGATTCCTGTTTTACAGG - Intronic
1162648234 19:12065270-12065292 GGGCCTGTTTAAGTTTTAACAGG - Intronic
933298839 2:80520548-80520570 GGGCCTTTTTCCGGAGTTGCAGG + Intronic
940556352 2:155233447-155233469 TGGCCTGTTTCAGTTTTTAGCGG + Intergenic
942672278 2:178388757-178388779 GGGCCTGGTTCCTGCTTTTCTGG - Intronic
943660079 2:190550269-190550291 GGGCCTGTTTCCCAGTTTATAGG + Intergenic
946271357 2:218596914-218596936 GGGCCTGTGGCCTGTTTCACTGG + Exonic
1171937096 20:31285503-31285525 GGGACTGCTTCAGGTTTTGCTGG + Intergenic
1174328664 20:49800094-49800116 GGGCCTGTTAAAGGCTTTACTGG - Intergenic
1174679418 20:52391171-52391193 GGTCCTGCTTCTGGTTTTAATGG + Intergenic
1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG + Intergenic
1177191253 21:17853632-17853654 GACCTTGTTTCCCGTTTTACTGG + Intergenic
1179796867 21:43789899-43789921 TGGCCTGTTCCCGCTGTTACCGG + Intronic
1180873487 22:19161978-19162000 GGGCCTGTTTCCGCTTACTCAGG - Intergenic
1184718617 22:46296331-46296353 GAGCCTGTCCTCGGTTTTACAGG - Intergenic
949104539 3:188318-188340 GGGCCAGTTTCCTGGTTTATAGG + Intergenic
950454677 3:13085629-13085651 TAGCCTCTTTCCAGTTTTACAGG + Intergenic
955840609 3:63108937-63108959 GGGCCTCTTTCAGGTTCTATTGG + Intergenic
956271564 3:67453379-67453401 GGGCCTGTTTCCTGGATTACAGG + Intronic
957034894 3:75284758-75284780 GGAACTGTTTCCTGTTTTACAGG - Intergenic
961304698 3:125950096-125950118 GGAACTGTTTCCTGTTTTACAGG + Intergenic
962714887 3:138117410-138117432 GGGCCTGTTTCCTGGTTGATAGG + Intergenic
962719070 3:138155782-138155804 GGGCCTATTTCCAGTCTTTCTGG + Intergenic
965968300 3:174523040-174523062 GGGCCCATTTCCTGTTTTACAGG - Intronic
979447732 4:120834423-120834445 GGGCCTGCTTCCTGTTTCATAGG - Intronic
981538368 4:145823874-145823896 GGGCCTGTCTGTGGTTTTCCCGG + Intronic
985342237 4:188967629-188967651 CGGCCTGTTTCCACTTTTATAGG - Intergenic
986063983 5:4218013-4218035 GGGCCTGTTCCTGGTTTTAATGG + Intergenic
994814895 5:104573170-104573192 GGGGCTTTTTCCTGGTTTACGGG - Intergenic
996224767 5:120978277-120978299 GGACCTGTTTCCAGTTTTGGGGG + Intergenic
996729708 5:126705259-126705281 TGGCATGTTTCCTGTTTTATTGG - Intergenic
1001265399 5:170270692-170270714 GGGCCCGTTTCCGGATTTTCTGG - Intronic
1001347225 5:170915348-170915370 GGGTCTGTTTTCTGTTTTTCTGG - Intronic
1004454373 6:15778118-15778140 GAGCCTGTTTCCACATTTACAGG - Intergenic
1010159496 6:72835728-72835750 GTGCCACTTTCAGGTTTTACTGG - Intronic
1011847505 6:91584684-91584706 GGGCCTGTTTCCTGGTTTGCAGG + Intergenic
1028151723 7:87381331-87381353 GGGGCTGTTTCAGGTTTGCCAGG - Intronic
1032386519 7:131529398-131529420 GGGCCTGCTTCCTCTGTTACTGG + Intronic
1035241756 7:157536573-157536595 TTCCCTGTTTCCAGTTTTACAGG + Intergenic
1040338570 8:46428486-46428508 GGCCCTGTTTCCGCTTGTAGGGG - Intergenic
1040862073 8:52008974-52008996 GGGCCTGTTTCCTGGTTCATAGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1045726452 8:105179157-105179179 GGCCCTGTTTCCTGTTATATGGG + Intronic
1047463811 8:125093152-125093174 GGGCCTGTTTCCTGGTTCATAGG + Intronic
1048142821 8:131811348-131811370 GGGCCTGATTCCTGATTTATAGG - Intergenic
1048366092 8:133740018-133740040 GGGCCTGCTTCCTGGTTCACTGG - Intergenic
1056871830 9:90289078-90289100 GGTCTTGTTTCTGGTCTTACAGG + Intergenic
1058940388 9:109807910-109807932 GGGGCTTTTTCCTGTTTTGCTGG + Intronic
1191852167 X:65593447-65593469 GGGTCTGTTTGTGGTTTTTCTGG + Intronic
1198850669 X:140962675-140962697 GGGCCTGTTTCCTGATTCATAGG + Intergenic
1200246921 X:154531389-154531411 GGGGCTGTTTGCGGATTTAATGG + Exonic