ID: 918016717

View in Genome Browser
Species Human (GRCh38)
Location 1:180641366-180641388
Sequence GACTCAAAGCTTGTTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918016717 Original CRISPR GACTCAAAGCTTGTTCCTCC AGG Intronic
901183302 1:7356477-7356499 GCCTCAGAGCCTCTTCCTCCTGG + Intronic
903126494 1:21251735-21251757 GTCCCAGAGCTGGTTCCTCCTGG - Intronic
903908214 1:26701738-26701760 AACTCAAAGCTATTTTCTCCTGG + Intronic
905924483 1:41740088-41740110 GACTCAAACCTAAGTCCTCCAGG + Intronic
906999289 1:50833639-50833661 TAATCAAGGCTTGTTCTTCCTGG + Intronic
907835161 1:58101880-58101902 GACTGAGAGTTGGTTCCTCCAGG + Intronic
909463845 1:75950378-75950400 GACTCACTTCTTTTTCCTCCTGG - Intergenic
912749443 1:112273744-112273766 GACACAAAGTTTGATCCTACAGG + Intergenic
915932395 1:160068623-160068645 GACTCATAGCTGGTTCTTCAGGG - Intronic
918016717 1:180641366-180641388 GACTCAAAGCTTGTTCCTCCAGG + Intronic
918242678 1:182634320-182634342 GACTCAAATCTGATACCTCCTGG - Intergenic
921939185 1:220822564-220822586 AACTCAAGGCTTGTGCCTTCTGG + Intergenic
923046935 1:230362451-230362473 GCCTCAAGGCCTGATCCTCCTGG + Intronic
1063329910 10:5147413-5147435 GACTCAAGGCAAGTTCCTGCTGG + Intergenic
1065771628 10:29083570-29083592 CACTGAAAGCTTCTTCCTCAAGG + Intergenic
1069507892 10:69018113-69018135 TACTCAAAGATTTTTCTTCCTGG - Intergenic
1070385452 10:75920064-75920086 CACTCAATGCTTGATTCTCCTGG + Intronic
1071186529 10:83052641-83052663 GTCCCAATGCTTGTTCATCCAGG + Intergenic
1075285617 10:121183350-121183372 GACTGAAAGCTTTCTCTTCCTGG + Intergenic
1075664159 10:124218953-124218975 GACTCAAGGATTCTTCCTCTGGG + Intergenic
1078434026 11:11309811-11309833 GCCTGCAAACTTGTTCCTCCTGG + Intronic
1080297241 11:30744390-30744412 GACTTTAATCTTTTTCCTCCAGG + Intergenic
1085087399 11:73679336-73679358 GACTCTAGGCTTTTTCCTCATGG - Intronic
1088718583 11:112572185-112572207 GAGTCAAAGGCTGTTCCCCCAGG + Intergenic
1088741988 11:112774802-112774824 GCCTCAGAGCTAGTTCTTCCTGG + Intergenic
1090650445 11:128801515-128801537 GGCTAAAAGCTTGTTCCCACAGG - Intronic
1095917412 12:47494157-47494179 AACTCAAAGCTTCTCCCTCCTGG + Intergenic
1098969100 12:76830523-76830545 GACTTAAAAATTGTTCCTCAAGG + Intronic
1100722336 12:97372233-97372255 CACTCAAAGCATGATGCTCCAGG - Intergenic
1101912004 12:108867045-108867067 GACTCAAAGCTTCTGCCACCTGG + Intronic
1103212158 12:119175019-119175041 GCCTCCAAGCTGGTTCCGCCAGG - Intergenic
1103894500 12:124264180-124264202 GACACTAAGCTTGTTCCACTGGG + Intronic
1105477219 13:20739038-20739060 TATTCAAAGTTTCTTCCTCCTGG + Intronic
1107307549 13:39038483-39038505 TACTCAAAGCTCGTGCATCCAGG + Exonic
1110032906 13:70639474-70639496 TACTCAAAGCTGCGTCCTCCTGG + Intergenic
1115272319 14:31567333-31567355 TACTCAAAGCTTGATACTGCAGG - Intronic
1116030841 14:39569322-39569344 GACTCAAACTTTGATCCTGCAGG - Intergenic
1122061363 14:99138751-99138773 CAACCAAAGCTTGTTCCTTCTGG - Intergenic
1126049291 15:44672164-44672186 GTCTAAAGGGTTGTTCCTCCTGG - Intronic
1127262772 15:57338030-57338052 GACTCACGGCTGCTTCCTCCTGG + Intergenic
1128924756 15:71645094-71645116 GTCTCAAAGCTGGTACCTCAGGG + Intronic
1129193072 15:73948694-73948716 GGCTCCAAGCTTGCTCCTCCAGG + Intronic
1129444077 15:75604058-75604080 TCCTCAATGCATGTTCCTCCAGG + Intronic
1130375137 15:83322299-83322321 GACCCAAAGCTAGTTGCTGCAGG - Intergenic
1130645560 15:85723441-85723463 AACTAAATGCTTGTTGCTCCTGG - Intronic
1139312957 16:66042571-66042593 AACTCAAGGCTGGTTCCGCCCGG + Intergenic
1142441852 16:90103618-90103640 GCCTCTCAGCTGGTTCCTCCTGG + Intergenic
1143378530 17:6481122-6481144 GACTCACATCATCTTCCTCCTGG - Intronic
1143644096 17:8218572-8218594 GACCCAAACCTTGTTCCTGAAGG - Intergenic
1144255203 17:13460804-13460826 GACTCAATGCTTCTTCCTTTTGG - Intergenic
1144641807 17:16941349-16941371 GACTCAGGACTTGTGCCTCCAGG + Intronic
1146428949 17:32772799-32772821 GAATGAAAGCTTCTTTCTCCTGG + Exonic
1146583189 17:34058385-34058407 GATTCAAGGGCTGTTCCTCCAGG - Intronic
1147920872 17:43916244-43916266 GACTCAAACCTTTTGCCTCAAGG - Intergenic
1149443788 17:56698087-56698109 GACTTACTGCTTGTGCCTCCTGG + Intergenic
1150226474 17:63527268-63527290 GCCTCCTAGCTTGGTCCTCCTGG - Intronic
1150492226 17:65582414-65582436 GCCTCAAATGTTCTTCCTCCTGG + Intronic
1151072753 17:71234891-71234913 GTCTCAAAGCTAATTCCTCTAGG - Intergenic
1152759889 17:82102238-82102260 GACTCAAAGCTCCTCCCCCCAGG + Intronic
1157412021 18:47471038-47471060 TACTGACAGCTTGTTCTTCCAGG - Intergenic
1158005420 18:52667019-52667041 GACTCACAGATTGTACCTTCTGG - Intronic
1158536454 18:58312492-58312514 GCCTCAAACGTTGTCCCTCCGGG + Intronic
1158598618 18:58838229-58838251 GATTCAAAGCTGGATCTTCCTGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166569484 19:43784739-43784761 GACCCCCAGCTTCTTCCTCCTGG - Intergenic
1167719704 19:51170060-51170082 GAATCAAAGAGTGTTCATCCTGG + Intergenic
926202983 2:10814469-10814491 GACTGCGAGCCTGTTCCTCCAGG + Intronic
926561905 2:14426946-14426968 GACTCAAAGATAGTTTCTTCAGG - Intergenic
926869489 2:17397496-17397518 GTCTCATATTTTGTTCCTCCAGG - Intergenic
927924226 2:26998733-26998755 GACTCCCAGCCTGTTCCTCTGGG - Intronic
929405294 2:41634801-41634823 GACTCAAACTTTGTTATTCCAGG - Intergenic
929561637 2:42960076-42960098 GAGTCAAAACTGCTTCCTCCTGG + Intergenic
934647485 2:96067683-96067705 CACTGAGAGCTTGTTTCTCCTGG - Intergenic
937611493 2:123867108-123867130 GTTTCATAGCTTGTTTCTCCTGG + Intergenic
939101262 2:137897425-137897447 CACACAAAGCTTGCTCCTGCTGG - Intergenic
940014597 2:149090528-149090550 TACTCTTAGCCTGTTCCTCCAGG + Intronic
942596791 2:177599189-177599211 GTATCAAAGCTGCTTCCTCCAGG - Intergenic
944280193 2:197886667-197886689 GACACTGAGCTTGTTCCCCCAGG - Intronic
946228604 2:218278065-218278087 GAGTCAAGGCTTAATCCTCCAGG - Intronic
948901229 2:240957810-240957832 GATGCCAAGCTTGGTCCTCCTGG - Intronic
1169855819 20:10101691-10101713 GCCTCAAAGCCTATTTCTCCTGG + Intergenic
1172658215 20:36549590-36549612 GACTCAGGGCCTCTTCCTCCTGG - Exonic
1173435552 20:43029064-43029086 AATTCAAAGCTTGTACCTCTGGG - Intronic
1178108516 21:29348250-29348272 GCCTCAAACCTAGTTCCTTCTGG - Intronic
1178605130 21:34029698-34029720 GAAGCAAAGCTGGTTCCTGCCGG + Intergenic
1178835827 21:36096714-36096736 GACTCAAAGCCTTTTTCACCAGG + Intergenic
1181311966 22:21949784-21949806 GACTGGCAGCTGGTTCCTCCTGG + Intronic
1183032133 22:35114231-35114253 GATTCAAAGCCAGCTCCTCCTGG + Intergenic
1183364328 22:37399245-37399267 GACTCAAAGCTGCCTCCTACAGG + Intronic
952577523 3:34793312-34793334 GATTCTAAGTTTGCTCCTCCGGG - Intergenic
953638789 3:44686129-44686151 GACTGAAAGCTGCTTCCACCTGG - Intergenic
958859869 3:99433561-99433583 GTCTCAAAGCAAATTCCTCCCGG - Intergenic
962214969 3:133513265-133513287 GACTCAAAACTTATTCCTGAAGG - Intergenic
968362117 3:198154585-198154607 GCCTCTCAGCTGGTTCCTCCTGG + Intergenic
968737736 4:2306147-2306169 GCCTCAATGCTTCTTCCTCCAGG - Intronic
968908436 4:3464889-3464911 GACTCACAGATTGTCCCACCTGG - Intronic
975975530 4:80091551-80091573 AACTGAAAGCTTGTTCCATCGGG + Intronic
976205310 4:82618561-82618583 GACTCCCAGCCAGTTCCTCCAGG - Intergenic
980385542 4:132085162-132085184 GACTCAAACCTTATTCCTGAGGG + Intergenic
980716810 4:136638534-136638556 CCCTCAAACCCTGTTCCTCCAGG + Intergenic
986499623 5:8385297-8385319 GACTCAAAGCTCCTTCATCATGG - Intergenic
988578307 5:32446970-32446992 TACTGAAAGGTTGTTCCTACAGG - Intergenic
991494949 5:67217603-67217625 GACTCAAAGCCTGCCACTCCTGG + Intergenic
991709823 5:69397750-69397772 AACTTAAAACTTATTCCTCCTGG - Intronic
993605227 5:89981935-89981957 TACTTAAAGCTTATTCCTCTTGG - Intergenic
993651876 5:90531300-90531322 GACAAAATGCTTGTTCCTACTGG - Intronic
994385818 5:99130257-99130279 GACTATAAGCTGTTTCCTCCTGG + Intergenic
1006407229 6:33852298-33852320 GACCCAAGGCTGGTGCCTCCAGG - Intergenic
1007449650 6:41933149-41933171 ATCTCCAAGCTTGTTTCTCCAGG + Intergenic
1007537030 6:42601286-42601308 GAATCAGAGCTGGTCCCTCCTGG - Intronic
1011303552 6:85901896-85901918 GCCACAAGGCTTGATCCTCCTGG + Intergenic
1012766577 6:103374677-103374699 GACTCACTGCTTATACCTCCAGG + Intergenic
1013246930 6:108295445-108295467 GACTCAGAGTTTGTTCCTTCCGG + Intronic
1015936119 6:138407415-138407437 GACTCAAAGCTCTTCCCTCTGGG + Intronic
1019253563 7:34122-34144 GCCTCTCAGCTGGTTCCTCCTGG - Intergenic
1019417023 7:932484-932506 GACTCAGGGCTGTTTCCTCCAGG + Intronic
1021857637 7:24873131-24873153 GACTCAAAGCAAGTTAGTCCAGG - Intronic
1024702427 7:51918592-51918614 GAGTAAATGCTTCTTCCTCCTGG + Intergenic
1027883933 7:83878567-83878589 GACTCAAAGTCTGTTACTCTTGG - Intergenic
1029904778 7:104080458-104080480 GACACAAAGCTTCATCCTCCAGG + Intergenic
1033480693 7:141737587-141737609 GACTCTTATTTTGTTCCTCCCGG + Intergenic
1033544660 7:142389150-142389172 GATTCAGGGCTTGGTCCTCCTGG - Intergenic
1033552802 7:142463065-142463087 GATTCAGGGCTTGGTCCTCCTGG - Intergenic
1033555127 7:142482503-142482525 GATTCAGGGCTTGGTCCTCCTGG - Intergenic
1033559729 7:142520038-142520060 GATTCAGGGCTTGGTCCTCCTGG - Intergenic
1033582931 7:142752938-142752960 GACTCCAGGCTTGTTCTTCTGGG - Exonic
1035986404 8:4437031-4437053 GACTCAGTGCTTTTTCCTCAAGG + Intronic
1036474483 8:9080769-9080791 CACTAAATGCTTGTTCCTGCAGG - Intronic
1038341954 8:26693601-26693623 GACGCACAGCCTGTTCCGCCTGG + Intergenic
1041896937 8:62936124-62936146 GACTTAATGCTTCTTCCTCATGG + Intronic
1043645445 8:82511604-82511626 GCCTCCAACCCTGTTCCTCCTGG - Intergenic
1044835709 8:96293486-96293508 CAGTTAAAGCCTGTTCCTCCTGG + Intronic
1045720313 8:105102197-105102219 GACTCCTTGCTTCTTCCTCCTGG + Intronic
1046998314 8:120548464-120548486 GCCTCAAAGTTCATTCCTCCAGG + Intronic
1050160854 9:2717703-2717725 GACGCCTAGCTTTTTCCTCCTGG - Exonic
1052059075 9:23938569-23938591 GATTCAAAGAGTGTTCCTACTGG - Intergenic
1052229806 9:26135617-26135639 CACTCACAGCTTCTTCCTCCTGG + Intergenic
1052901704 9:33799098-33799120 GACTCCAGGCCTGTTCTTCCAGG - Exonic
1056068688 9:82963593-82963615 GACCCAATGTTTGTTTCTCCTGG + Intergenic
1057257990 9:93566740-93566762 TACTCCCAGCTTTTTCCTCCCGG + Intergenic
1057507334 9:95646193-95646215 GACTCAATGCCTGTTTCTCTTGG - Intergenic
1058470739 9:105276103-105276125 GACTCTAAGATTGTTCTTCCAGG - Intronic
1059044435 9:110850538-110850560 GACTCCAGGCTTGTTCCATCTGG + Intergenic
1062746804 9:138218247-138218269 GCCTCTCAGCTGGTTCCTCCTGG + Intergenic
1197595676 X:128461190-128461212 CACTCAAACCTTGGTCCTTCTGG + Intergenic
1197841250 X:130749394-130749416 GAAACAAAGCATTTTCCTCCAGG + Intronic
1198083223 X:133259344-133259366 GACAGAAAACTTGTTCCTCCTGG + Intergenic