ID: 918017006

View in Genome Browser
Species Human (GRCh38)
Location 1:180644998-180645020
Sequence AAAACCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 21, 2: 41, 3: 43, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918017005_918017006 9 Left 918017005 1:180644966-180644988 CCGTAATCTGGTTTTGGTTGCTG 0: 1
1: 13
2: 15
3: 18
4: 185
Right 918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG 0: 1
1: 21
2: 41
3: 43
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918017006 Original CRISPR AAAACCTGCTTCACAAAGAT AGG Intronic