ID: 918017006

View in Genome Browser
Species Human (GRCh38)
Location 1:180644998-180645020
Sequence AAAACCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 21, 2: 41, 3: 43, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918017005_918017006 9 Left 918017005 1:180644966-180644988 CCGTAATCTGGTTTTGGTTGCTG 0: 1
1: 13
2: 15
3: 18
4: 185
Right 918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG 0: 1
1: 21
2: 41
3: 43
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918017006 Original CRISPR AAAACCTGCTTCACAAAGAT AGG Intronic
902061321 1:13645775-13645797 AAATCTTGCCTCACACAGATAGG + Intergenic
905664429 1:39754128-39754150 AAAACCTGATTCATAAAAACAGG - Intronic
906124477 1:43419197-43419219 AAAACTCGATTCACAAAAATAGG + Intronic
908648060 1:66301172-66301194 AAAATCTGCTTCTCTAATATTGG - Intronic
908899697 1:68942413-68942435 AAAGCCAGCTTCACAAATGTTGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
910824074 1:91387271-91387293 GAATTCTGCTTCACAATGATAGG + Intronic
910833080 1:91479817-91479839 TAAACATGATCCACAAAGATGGG + Intergenic
911177645 1:94833144-94833166 AAAACCTGTTTCAGCAAGCTGGG - Intronic
911293004 1:96080773-96080795 GAAGGCTGCCTCACAAAGATTGG - Intergenic
911519880 1:98916616-98916638 ATAACTTTCTTTACAAAGATAGG + Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913650302 1:120907202-120907224 AAAACCTCCTCCACAAATATTGG + Intergenic
914170816 1:145221872-145221894 AAAACCTCCTCCACAAATATTGG - Intergenic
914525931 1:148465831-148465853 AAAACCTCCTCCACAAATATTGG - Intergenic
914640471 1:149601285-149601307 AAAACCTCCTCCAAAAATATTGG + Intergenic
915617250 1:157048061-157048083 AAAAGATGCTTGCCAAAGATAGG + Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918223616 1:182458301-182458323 AAAACCTGCAAAACAAAGCTAGG - Exonic
918589558 1:186225032-186225054 AAAACCTTCTTTACATAGCTAGG - Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920564438 1:206962168-206962190 AGAACGTGCTTCACCAAGCTTGG + Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921029170 1:211322303-211322325 AAAACCTGTATCACAATGAGAGG + Intergenic
921215520 1:212933635-212933657 AAAACTTGCTTCTCAAAGTGGGG + Intergenic
922273194 1:224053260-224053282 AACACCTGCTACTCAAAGATGGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065468508 10:26051764-26051786 AAAACTTCATTCACAAAAATAGG - Intronic
1066585600 10:36931039-36931061 AAAACCTGCTTGACTCAGTTGGG - Intergenic
1067132676 10:43579241-43579263 AAAACATTCTTCACAGAAATAGG - Intergenic
1067533301 10:47090222-47090244 AAAACTTTATTGACAAAGATAGG - Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068635441 10:59343220-59343242 AACACCTGCTTCATTATGATAGG - Intronic
1068941308 10:62683890-62683912 AAAACTTGATTCACAAAAACAGG + Intergenic
1069235417 10:66065466-66065488 AAAACCTTATTTAAAAAGATAGG - Intronic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071979903 10:90994216-90994238 AAAACCAGCTTCTCAAAAGTGGG - Intergenic
1072508036 10:96089936-96089958 AAAACTTGGTACACAAAGAAGGG + Intergenic
1072752645 10:97994236-97994258 AAAAACTCCTTCACAAACCTAGG + Intronic
1075173520 10:120137983-120138005 AAAACTTTATTCACAAACATGGG + Intergenic
1075625071 10:123958130-123958152 AAAATCTTCTCCACAAATATTGG - Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079984044 11:27181342-27181364 AAAACATGATTTACAAAGACAGG + Intergenic
1080166192 11:29240746-29240768 ACTACCTGCTTCATAAAGAAAGG - Intergenic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1081244542 11:40747976-40747998 AAAACCTAGTTAACAAAAATAGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084555422 11:69872823-69872845 CAAACCTGATACACAAAGACTGG - Intergenic
1085035123 11:73295338-73295360 ATAACCTGCTTCACACAGCATGG + Intronic
1086075556 11:82847579-82847601 AAAACCTGGATCAAAATGATAGG - Intronic
1087405886 11:97730012-97730034 AAAACCCTCTTCATAAAGAGAGG - Intergenic
1088083001 11:105942864-105942886 TAAAACTGCTTCCCAAAAATGGG + Intronic
1089946652 11:122480633-122480655 AAAGCCTGCTCAAGAAAGATAGG + Intergenic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1090885574 11:130873215-130873237 AAAACTTGATTTACAAAAATAGG - Intergenic
1093645892 12:21584931-21584953 AAAAGCTGCTTCAGGATGATAGG - Intronic
1094045947 12:26167334-26167356 AAAACCTTATGGACAAAGATTGG + Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1097252563 12:57644482-57644504 ATAACCTGCTTCACAACCCTAGG - Intergenic
1098287852 12:68926521-68926543 AAAAGCAGCTTGACACAGATGGG - Intronic
1099166724 12:79315925-79315947 AAAACAAGCTGCAAAAAGATTGG - Intronic
1100383894 12:94087776-94087798 AGAGCCTGCTTCCCAAAGAAAGG - Intergenic
1100759840 12:97795146-97795168 ATAAGTTGCTTCACAAAGACTGG - Intergenic
1102226415 12:111231596-111231618 AAAACTTTATTTACAAAGATAGG - Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1106855795 13:33851235-33851257 ATTTCCTGCTTTACAAAGATTGG + Intronic
1107655626 13:42589899-42589921 AAAACCGACTACACAAAGAAGGG - Intronic
1109945548 13:69426853-69426875 AAAACCAGCATGACAAACATAGG + Intergenic
1111248994 13:85578859-85578881 AAAACCGGCTGAACAATGATAGG - Intergenic
1112249759 13:97769049-97769071 TACAGCTGCTTCAGAAAGATGGG + Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113349718 13:109517146-109517168 AAAACCTCCTACACAAAGGCAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114284222 14:21225009-21225031 GAAACCTGGTTCAAAAAGACTGG - Intronic
1114505233 14:23206593-23206615 ATAACCTGTTTCACAAACCTAGG + Intronic
1115149646 14:30269836-30269858 AAAACCTGCTTGAGAAAAAATGG + Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116592029 14:46789260-46789282 AAAACATGCTTGGCAAAGAATGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118615170 14:67570016-67570038 AGAAACTGCTGCACAAAGAGGGG + Intronic
1118870795 14:69739697-69739719 CAAACCTGTCTGACAAAGATGGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121034325 14:90687638-90687660 CAAACCTGCTTCACAATGAGGGG + Intronic
1121665883 14:95671894-95671916 AAAATGTGCTTCACAAAGCTAGG + Intergenic
1121669730 14:95699267-95699289 AAAAACTCCTTCACACACATGGG + Intergenic
1124105263 15:26731938-26731960 AAGACCAGCTTCTCACAGATAGG + Intronic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124712598 15:32028459-32028481 AAAACCTGAGTCCCATAGATGGG + Intergenic
1126168244 15:45672001-45672023 AAAACCTGCGTCAAAAAGGGTGG - Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127789459 15:62386566-62386588 AAGACCAGCTTCACCAACATAGG - Intergenic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1128834344 15:70797012-70797034 GAAACCTCAGTCACAAAGATCGG - Intergenic
1129873269 15:78955373-78955395 AAAAACTCCTTCACAGAGTTGGG + Intergenic
1129928097 15:79384111-79384133 AAAAGCTTCTTCTCAAACATTGG + Intronic
1131036893 15:89228468-89228490 AAAAAATGCTCCACAAAAATGGG + Intergenic
1131571981 15:93547364-93547386 AAAACCAGCTAAACAAAAATAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131866043 15:96711075-96711097 AAAACCTGCTTCCCAACAGTGGG + Intergenic
1136049199 16:27638575-27638597 AAAAGCTGCTCCACCAAGAGAGG + Intronic
1138345370 16:56317047-56317069 AAAACCTGCTTCTCAGTCATTGG + Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139112367 16:63906214-63906236 AAAATCAGGTTCACAAATATTGG + Intergenic
1139353950 16:66355998-66356020 AAAAGCAGCTGCCCAAAGATGGG - Intergenic
1140127635 16:72131413-72131435 AAAAACTGCTTCAGGAAAATTGG + Intronic
1140325484 16:73997509-73997531 AAAACTTTATTCACAAAAATAGG + Intergenic
1140458814 16:75121587-75121609 ATAACCTGCTTCACAACCCTAGG - Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1140764403 16:78143455-78143477 AAAACCTGATTTACAAAAGTGGG - Intronic
1140827308 16:78718725-78718747 AAAACATCCTTCAGAAACATTGG - Intronic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1149679210 17:58493285-58493307 AAAACCTGATTTACAAAAACAGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1152707986 17:81855160-81855182 AATACCAGCTCGACAAAGATGGG - Exonic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155732343 18:29176597-29176619 AAAATCTGCTTCAGAATGCTTGG - Intergenic
1156832344 18:41507277-41507299 AAAACCTTATTCACTAAAATGGG - Intergenic
1158470671 18:57733741-57733763 AACAACTGCTTCACAAGGAGAGG + Intronic
1158786200 18:60714213-60714235 AATACCTGTTTCAGAAAGAATGG + Intergenic
1158947776 18:62462561-62462583 AATACGTGCTTAACAAATATCGG - Intergenic
1159292285 18:66439114-66439136 AAAAGCAGCTTAATAAAGATTGG + Intergenic
1159399494 18:67912365-67912387 AAGAACAGCTTCACAAAAATAGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1162141324 19:8587026-8587048 AACACCTGGTTCACAAGGGTGGG - Intronic
1164085762 19:21900891-21900913 AAAATCTCCTTCAGAAAGAAGGG - Intergenic
1167824236 19:51957582-51957604 GAAAGCTGCTACAAAAAGATGGG - Intergenic
1167840439 19:52113215-52113237 CAAATCTGCTTCTCCAAGATTGG - Exonic
1167844711 19:52152510-52152532 CAAGCCTGCTTCTCCAAGATTGG - Intergenic
926620525 2:15043003-15043025 AAAACTTGCTTTACAAAAACAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927393181 2:22619204-22619226 AAAACCTGTTTCAAAAACCTGGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928896378 2:36269096-36269118 AAAAACTGCCTCACGAAGTTTGG - Intergenic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
930230302 2:48836174-48836196 ATAACATGCTTCACAGAAATAGG - Intergenic
930629382 2:53735649-53735671 AAAAACTGATTCATACAGATGGG + Intronic
930638717 2:53833623-53833645 ATGACCTGTTTCACAAAAATAGG + Intergenic
931858355 2:66327893-66327915 AAAAGCTGACTCAGAAAGATAGG - Intergenic
932771052 2:74501050-74501072 AAAGACTCCTTGACAAAGATGGG + Intronic
933082418 2:78007204-78007226 AAAACCTGCTTTATATGGATAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
935057527 2:99580596-99580618 AAAACCTGCTTCGCAGAGGCCGG + Intronic
936686385 2:114831465-114831487 CAAACCTGCTTCCCGAAAATTGG - Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
939177783 2:138769655-138769677 AAATCCTGCTGCACTAAGCTGGG - Intronic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
940026707 2:149215953-149215975 AAAAACTTATTCACAAAAATGGG - Intergenic
940681654 2:156793106-156793128 TAAACTTGCTACTCAAAGATTGG - Intergenic
943165372 2:184316193-184316215 AGAAGCTGCTTCAAAATGATGGG - Intergenic
943564282 2:189498933-189498955 AAAAGCTGCTTCAGGAAGTTGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944321711 2:198352438-198352460 AAAATCAGTTTCACAAAGTTAGG + Intronic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
945577630 2:211552004-211552026 AAAACGTGGTTCACAATGATTGG - Intronic
945965028 2:216177740-216177762 AATACATGCTTGACAAAAATGGG - Intronic
946072543 2:217046997-217047019 AAAACCTGCTTCTGAAGCATTGG + Intergenic
946103506 2:217349189-217349211 AAAACTTGCTTTACAAATCTGGG + Intronic
946257602 2:218456995-218457017 AAAACACACTTCACAAAGCTAGG + Intronic
947034820 2:225840195-225840217 GAAACCTTCTTAACAAAGACTGG + Intergenic
1169959625 20:11144724-11144746 CAAACCTGCTCCACGAAGACAGG - Intergenic
1170581282 20:17701339-17701361 AACACCTGCTTCACAGAGGTCGG - Intronic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1170993153 20:21323813-21323835 AAAACCTGACTCACAAAAACAGG - Intronic
1173565674 20:44036642-44036664 AAAACCTTATTTACAAAAATGGG - Intronic
1174158880 20:48536303-48536325 AAAACTTGATTTACAAAAATAGG - Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG + Intronic
1176550366 21:8218333-8218355 GAATTCTGCTTCACAATGATAGG - Intergenic
1176569294 21:8401371-8401393 GAATTCTGCTTCACAATGATAGG - Intergenic
1176577208 21:8445603-8445625 GAATTCTGCTTCACAATGATAGG - Intergenic
1177034306 21:16022891-16022913 AAAACCTGCTTTTCAAGTATTGG + Intergenic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180664944 22:17503399-17503421 ATAACCAGCTTCTCAAAGAGAGG + Intronic
1182171801 22:28237845-28237867 AAAATCTGCTTCAAAAATAGAGG - Intronic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1203255261 22_KI270733v1_random:134671-134693 GAATTCTGCTTCACAATGATAGG - Intergenic
1203263317 22_KI270733v1_random:179750-179772 GAATTCTGCTTCACAATGATAGG - Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
950958626 3:17081113-17081135 ACCACCTGCTCCACAAAGAGGGG - Intronic
952608215 3:35174787-35174809 ATGACCTTCTTCACAAATATAGG - Intergenic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
955444826 3:58998607-58998629 ATATCCTCCTCCACAAAGATAGG - Intronic
955496191 3:59535215-59535237 AATACCTGTTTCAGAAAGAGAGG - Intergenic
956291510 3:67665399-67665421 AAAACTTTATTTACAAAGATAGG - Intergenic
956504948 3:69928088-69928110 AAAACCTTATTGACAAAAATGGG + Intronic
956613442 3:71147305-71147327 AAAGCCTGCCTTTCAAAGATGGG + Intronic
957894641 3:86405554-86405576 AAAACTTTATTCACAAAAATGGG - Intergenic
958422793 3:93947421-93947443 AAAAACTGCTCCCTAAAGATAGG + Intronic
960001631 3:112737753-112737775 AAAACCTGCTTTACACAAATTGG + Intergenic
960744216 3:120868639-120868661 GAAACCAGATTCAGAAAGATTGG + Intergenic
961070130 3:123916368-123916390 AAAACTGGCCTCACAAAGGTAGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
963096948 3:141553147-141553169 AAAATCTGATTCATAAATATAGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963442869 3:145362726-145362748 CAAAGCTGCTACACAAAGGTAGG + Intergenic
963896466 3:150690357-150690379 ATAACCTGTTTCACAACGCTAGG - Intronic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
964731704 3:159874085-159874107 AAAACTTCCTTCACAATGTTAGG - Intronic
966369134 3:179228548-179228570 AAATCTGGCCTCACAAAGATAGG - Intronic
966681997 3:182651665-182651687 AAATCCTGTTGCACTAAGATCGG - Intergenic
966957675 3:184900326-184900348 TATACCAGCTTCACAAAAATGGG + Intronic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
970967987 4:21949278-21949300 AAATACTGCTGCACAAAGTTAGG + Intergenic
971063468 4:22999729-22999751 TTAACCTGAATCACAAAGATTGG - Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
971808077 4:31386757-31386779 TAAACCTCCTCCACAAAGAGAGG + Intergenic
971929986 4:33069071-33069093 TGAACCTGCTTCACAAAATTGGG + Intergenic
974822921 4:67090818-67090840 GAATACTGCTTCAAAAAGATTGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977239801 4:94554521-94554543 AAAACATACTTCAGGAAGATAGG + Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978874288 4:113620088-113620110 AAAATGTGTTTCTCAAAGATAGG + Intronic
979152688 4:117340693-117340715 AAAACTTGCTTTATAAATATAGG + Intergenic
979300364 4:119080003-119080025 AAATCCTTCTCCACAAATATTGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983106422 4:163691949-163691971 AATAGCTGCTTGACAGAGATGGG + Intronic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987423019 5:17743227-17743249 AAAAGCTGCTTTACAAAGTCTGG - Intergenic
987460334 5:18200964-18200986 AAAACCTGTTTCACAACCCTAGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988912221 5:35854850-35854872 TAAGCCTGATTCACAAAAATTGG - Intronic
989750407 5:44885970-44885992 AAAACCACATCCACAAAGATTGG - Intergenic
989981405 5:50649745-50649767 AAAACCTCCTCCACAAATATTGG + Intergenic
990826020 5:59898825-59898847 AAAACCTGCTCCACTCAGAAGGG - Intronic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
993953997 5:94210109-94210131 TAATCATGCTCCACAAAGATGGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996039161 5:118791277-118791299 AAAACTTTCTTCACAAAAATAGG - Intergenic
996085670 5:119302481-119302503 AAAACATCCTTCCCAAAGACAGG - Intronic
997719101 5:136063979-136064001 AAAACCTGTTTGGCAAAGACAGG - Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998706526 5:144768426-144768448 AAAACTGGCTTCAGAAATATTGG + Intergenic
998716117 5:144886519-144886541 TAAACCTGTTACACAAGGATGGG + Intergenic
998846493 5:146315466-146315488 AGTACCTGCTTCACAGGGATAGG - Intronic
999130926 5:149282569-149282591 AAAACTTTCTTTACAAAGACAGG - Intronic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
999501731 5:152153494-152153516 AAAATTTGCTTCAAACAGATTGG + Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003803437 6:9698143-9698165 CAAATCTGCTTCAGAAAGAAAGG - Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1005006537 6:21292796-21292818 AAAACATACTATACAAAGATAGG - Intergenic
1005849294 6:29807817-29807839 AAAACATCCTTAACAAACATTGG + Intergenic
1005861081 6:29901409-29901431 AAAACATCCTTAACAAACATTGG + Intergenic
1006758172 6:36436032-36436054 ATAAACTGCTTAACAATGATTGG + Intronic
1006979535 6:38135890-38135912 AATACCTGCTCCACAGAGAAGGG - Intronic
1008374302 6:50773794-50773816 AAGTCCTGCTTCTCAGAGATGGG + Intergenic
1009947575 6:70357440-70357462 AAAATGTGCTTCTCCAAGATTGG + Intergenic
1010642688 6:78348875-78348897 AATACATGCTTTACAAAGATGGG - Intergenic
1011673887 6:89712326-89712348 AAAACCTCTTTCACAAATATTGG + Intronic
1011681864 6:89791184-89791206 AAAAGCTGATGCACAAAGGTAGG + Intronic
1012179315 6:96131539-96131561 AAAACTTTCTTCTCAGAGATAGG - Intronic
1012319995 6:97831460-97831482 AAAACATGCTTGATAAAGCTAGG + Intergenic
1012875679 6:104722658-104722680 AAAACCAGCTACAGAAACATTGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013568973 6:111401258-111401280 AATACAACCTTCACAAAGATGGG + Intronic
1013789217 6:113816911-113816933 AAAACATAATTAACAAAGATTGG + Intergenic
1014827757 6:126065961-126065983 AAATGCTGCTAGACAAAGATGGG + Intergenic
1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG + Intergenic
1016983168 6:149871876-149871898 AAAACCTGCTTTTCAAAAACTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018924516 6:168197150-168197172 AAAAGCTGCTTCAAGAAGAAAGG + Intergenic
1018980913 6:168601196-168601218 AATGCCTGTTTCACCAAGATCGG + Intronic
1020588944 7:10109538-10109560 AAAACCTGGTTGAGAAAGAATGG + Intergenic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1020982633 7:15090454-15090476 AAAACATGCTTTACAAAGAATGG + Intergenic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1024062970 7:45712850-45712872 AATTTCTGCTTCACAAAGTTAGG - Intronic
1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG + Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1028024152 7:85815979-85816001 AAAATCTACTTCAGAAAGTTTGG - Intergenic
1028105897 7:86878333-86878355 ATCACCTCCTTCCCAAAGATGGG + Exonic
1028217453 7:88151968-88151990 AAAAACTGCTTCCAAAAGTTTGG - Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1032230470 7:130069923-130069945 TAAACCTGGTTAACAAATATGGG - Intergenic
1032465978 7:132145349-132145371 AAAACCTGCCTCACAGACCTAGG + Intronic
1032948689 7:136882323-136882345 GAAACCTGCTCCATAAGGATGGG + Intronic
1032993377 7:137418759-137418781 AAAAACTGCTAAACAAAGAATGG + Intronic
1033200789 7:139367905-139367927 AAAAGCTGCTTATCAAAGAGAGG + Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1040507921 8:48068205-48068227 AAAGCCAGGTTCACAAAGCTTGG + Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG + Intergenic
1043326309 8:79056158-79056180 AAAACTTGATTTACAAAAATAGG + Intergenic
1043836943 8:85059622-85059644 GAAAGCTGCTTCATAAAGTTGGG - Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044455579 8:92389099-92389121 AATACCTGCCTCAAAGAGATGGG + Intergenic
1045995054 8:108352528-108352550 AAAACCTTCTCAAGAAAGATGGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1047175468 8:122536558-122536580 AGAACTTGCTTGAAAAAGATGGG - Intergenic
1049483937 8:142841645-142841667 AAAACCTACCACACACAGATGGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050644746 9:7707221-7707243 AAAACCTGCTCTAGAAAGATTGG + Intergenic
1050754855 9:8990071-8990093 AATACCTTCTTCACAAATAATGG - Intronic
1051034622 9:12728671-12728693 AAGACCTGCTTAAGAAAGACGGG + Intergenic
1051091635 9:13416563-13416585 AAAACCACCTTCAGAAAGGTGGG + Intergenic
1052125753 9:24772748-24772770 ACACCCTGCTTCATAAAGGTTGG - Intergenic
1052195542 9:25708893-25708915 AAAACCTGCATCACAACTCTGGG - Intergenic
1053559223 9:39172288-39172310 GAAACTTTCTTAACAAAGATTGG - Intronic
1053823340 9:41992529-41992551 GAAACTTTCTTAACAAAGATTGG - Intronic
1054137888 9:61446658-61446680 GAAACTTTCTTAACAAAGATTGG + Intergenic
1056689102 9:88791082-88791104 AAATTCTGCTTCAAAAAAATTGG - Intergenic
1057318862 9:93993429-93993451 AAAGCCTTCTTTACAAAAATAGG + Intergenic
1057547458 9:96028678-96028700 ACAACCTGACTCAGAAAGATGGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1060057327 9:120426042-120426064 AAGAACTGCTTTATAAAGATGGG + Intronic
1203471659 Un_GL000220v1:117808-117830 GAATTCTGCTTCACAATGATAGG - Intergenic
1203479480 Un_GL000220v1:161780-161802 GAATTCTGCTTCACAATGATAGG - Intergenic
1186224586 X:7384460-7384482 AAGACCTGCTTCAAAATCATTGG + Intergenic
1187616238 X:20996694-20996716 ATAACCTGCTTCACAATCCTAGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188246239 X:27839369-27839391 AAACCCTGCTTTGTAAAGATAGG - Intergenic
1189211748 X:39289686-39289708 ATAACCTACTTCACAAAGTTAGG + Intergenic
1189515764 X:41712113-41712135 AAATCCTGCGTCAAAAAGGTGGG + Intronic
1189646995 X:43143953-43143975 AAAACTTTCTTTACAAAAATAGG + Intergenic
1192778973 X:74274929-74274951 AAAACCTGATTTACAAAAACAGG - Intergenic
1193529612 X:82641400-82641422 AAAACCTTTTTAACAAGGATGGG - Intergenic
1195133903 X:101884174-101884196 AAAACTTGTTTCAGAAAGATAGG - Exonic
1195616269 X:106914459-106914481 AAATCCAGCCCCACAAAGATAGG - Intronic
1196071342 X:111526301-111526323 ATGACATGCTTCACAAAAATAGG + Intergenic
1198184511 X:134240275-134240297 AAAAACTGCTCCACCAAAATAGG - Intronic
1199144115 X:144346086-144346108 AAAGCCTTCTTAAAAAAGATGGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic