ID: 918018664

View in Genome Browser
Species Human (GRCh38)
Location 1:180663710-180663732
Sequence TTGTGTTCTTCTCTTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 2, 2: 15, 3: 102, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918018657_918018664 18 Left 918018657 1:180663669-180663691 CCTAGGGCTCTATATTCAGCAGG 0: 2
1: 23
2: 259
3: 636
4: 1150
Right 918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG 0: 1
1: 2
2: 15
3: 102
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918018664 Original CRISPR TTGTGTTCTTCTCTTAAGGG TGG Intronic
904539446 1:31222980-31223002 TTGTCCTCTTTTCTTCAGGGAGG + Intronic
905197749 1:36294032-36294054 TTGTGTTTTTCTTTTAAGGATGG + Intronic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
908839709 1:68266719-68266741 TTAGGTACTTCTCTAAAGGGTGG - Intergenic
909209637 1:72807536-72807558 TTGTGTTCTTACGTTCAGGGTGG + Intergenic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
909309516 1:74129175-74129197 TTGTTTTCTTTTCTTCAGTGTGG + Intronic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
910515303 1:88053993-88054015 TTGTGTCCATCCCTTCAGGGTGG + Intergenic
911239306 1:95448467-95448489 TTGTGTGCTTCCCTTCAGGGTGG + Intergenic
911975584 1:104489949-104489971 TTGTGTTCTTCCCTTTAGGGTGG - Intergenic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912633186 1:111267097-111267119 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
913706998 1:121434936-121434958 TCGTGTCCTTCCCTTCAGGGTGG - Intergenic
916360646 1:163963350-163963372 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
916610633 1:166388058-166388080 CTGGGTTCTTCTCTTCAGGAAGG + Intergenic
917003279 1:170385009-170385031 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
917373005 1:174316720-174316742 CTGTGTCCTTCCCTTTAGGGTGG + Intronic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
919187090 1:194165787-194165809 TTGTGTTATTCTCTAGAGGGAGG - Intergenic
919455978 1:197819490-197819512 TTCTGTTCTTCCCTTAAGGGTGG - Intergenic
919985487 1:202671183-202671205 TTGAGTTCTTTTCTCAAAGGTGG - Intronic
920133201 1:203748761-203748783 ATTTGTTCTTCTCTTAAGCATGG - Intergenic
920230223 1:204465316-204465338 GTCTGCTCTTCTCTTAAAGGTGG - Exonic
921351561 1:214241510-214241532 TTGTGTTCCTCCATTCAGGGAGG + Intergenic
921939336 1:220824128-220824150 TTGTGTGCTTCTCTATGGGGTGG + Intergenic
922021522 1:221709727-221709749 TTGTTTTCTTCTCTTGGGGAAGG + Intronic
923057649 1:230439300-230439322 TTTTGTTCTTCACAGAAGGGTGG - Intergenic
923129904 1:231066139-231066161 TGGTGATCTTCTCTTAGGGGAGG - Intergenic
923886535 1:238164135-238164157 CTGTGTCCTTCTTTTTAGGGTGG + Intergenic
924516104 1:244767784-244767806 TTGTGCTCTTCCCTTCAGAGCGG + Intergenic
1064487276 10:15806936-15806958 ATGAGTTGTTTTCTTAAGGGAGG + Intronic
1064737434 10:18396979-18397001 TTGTGTTCTTCTCTTTCTGTAGG - Intronic
1064843359 10:19622058-19622080 TTATGGTTTTCTCTTAAGGAAGG - Intronic
1064987428 10:21225453-21225475 TTATGTTCTTCTCTTGAGGGTGG + Intergenic
1065232014 10:23608055-23608077 TTGTGCTGTCCTCATAAGGGTGG - Intergenic
1065708572 10:28493955-28493977 TAAGTTTCTTCTCTTAAGGGAGG - Intergenic
1066601369 10:37111016-37111038 TTGTGTTCATTTGTTATGGGAGG + Intergenic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1067086292 10:43241812-43241834 TTGTGTTCTTCTCTCTAAAGTGG - Intronic
1067196791 10:44126755-44126777 TTTTGTTCCTCTCTCAAGGCAGG + Intergenic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1069031036 10:63596526-63596548 TTGAGTTCTTCTGTCAAGGTGGG - Intronic
1069582540 10:69575447-69575469 TTGTCTTCTTCTCATAAGAATGG + Intergenic
1069790117 10:71014115-71014137 TTGTTTTCTTCTCTGAAGGCAGG - Intergenic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1074597285 10:114879226-114879248 TTGTGATCTGATCTTAATGGAGG + Intronic
1074923263 10:118040562-118040584 TTTTTTTCTTCTCTTTAAGGTGG - Exonic
1075886422 10:125903359-125903381 TTGGGTATTTTTCTTAAGGGAGG + Intronic
1076457712 10:130613073-130613095 TTGTTTTTTTCTCTTAAGACTGG + Intergenic
1077427513 11:2490353-2490375 TTTTGTCCTTCACTTTAGGGTGG - Intronic
1077970644 11:7185942-7185964 TTATGTTCTTCTCTGGAGAGTGG + Intergenic
1078897810 11:15613230-15613252 TTGTCCTCTTCTCATTAGGGTGG - Intergenic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1079686946 11:23370895-23370917 CTGTATTCTTCTCTTCAGTGTGG - Intergenic
1079961335 11:26927860-26927882 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1080128661 11:28767168-28767190 TTGTGTCCTTCCCTTCAGTGTGG - Intergenic
1080413810 11:32051221-32051243 TTGTGTGCTTTTCTTAAGCTTGG + Intronic
1081576560 11:44322189-44322211 TAGTTCTCTTCTTTTAAGGGAGG + Intergenic
1082122670 11:48396268-48396290 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082205013 11:49422591-49422613 TTGTGTTTTTTTCCTAAGAGTGG + Intergenic
1082251965 11:49992404-49992426 CTGTGTCCTTCTTTTCAGGGTGG - Intergenic
1082556374 11:54567544-54567566 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082823716 11:57562404-57562426 TTGTGTTCTTCCCCTTAGGGTGG - Intronic
1083512695 11:63226711-63226733 TTGTGTCCTTCCTTTCAGGGTGG + Intronic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1085572038 11:77568375-77568397 TTGTGTCCTTCCTTTTAGGGTGG + Intronic
1085981573 11:81732697-81732719 CTGTGTTCTTCCCTTCAGGATGG + Intergenic
1086068839 11:82776434-82776456 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1086156080 11:83667465-83667487 TTGTTTTCTAGTCTTAAAGGAGG + Intronic
1087147413 11:94825864-94825886 TTGTGTCATTCTCTGAAAGGAGG + Intronic
1087268431 11:96085824-96085846 TTGTGTTCATTTCTTTATGGAGG + Intronic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1087950738 11:104218309-104218331 TTATGTTCTTCCCTTCAGGGTGG + Intergenic
1088009894 11:104986897-104986919 TTGTGTTCTTCCATTCAAGGTGG - Intergenic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088411436 11:109539148-109539170 TTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1089883153 11:121794486-121794508 CCGAGTTCTTCTCTTAAGAGAGG + Intergenic
1090318212 11:125816785-125816807 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
1091142933 11:133251563-133251585 TTGTGTTCTTTTTTTGGGGGGGG + Intronic
1091354565 11:134926289-134926311 TTGTGTTCTTGTGTTGAGAGGGG - Intergenic
1092072138 12:5640010-5640032 CTGTTTTCTTCTTGTAAGGGGGG - Intronic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1093419952 12:18964176-18964198 TTGTGTTCTTCCCTTCAGGATGG + Intergenic
1093903217 12:24660670-24660692 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1095169777 12:39020302-39020324 TTATGTTCTTCCCTTCAGGGTGG - Intergenic
1095368856 12:41442194-41442216 TTTTGCTTTTCTCTTAAGGTAGG + Intronic
1097425966 12:59445477-59445499 TTGTGTCCTTCCATTCAGGGTGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098142831 12:67468792-67468814 TTGTGTCCTTCCCTTTAGAGTGG + Intergenic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098688365 12:73454830-73454852 TTATTTTCTTCTCTTAAGTAAGG - Intergenic
1099465452 12:82981168-82981190 TTGTCTTCTTTTCTTAACAGTGG + Intronic
1099505994 12:83476671-83476693 TTGTTTTCTTCTTTGAAGGAGGG + Intergenic
1099564838 12:84230220-84230242 CTGTGTTCTTCCCTTTAGGATGG + Intergenic
1100837365 12:98579302-98579324 TTATTTTCTTCTCTTCAGGCAGG + Intergenic
1100909098 12:99338095-99338117 TTGTGTACTTCCCTTCAGGGAGG + Intronic
1100923883 12:99521949-99521971 CTGTGTCCTTCCCTTTAGGGCGG + Intronic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1106009996 13:25811055-25811077 TTTTTTTTTTCTTTTAAGGGAGG - Intronic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106349903 13:28920623-28920645 TTGTGTCCCTTTCTTCAGGGTGG + Intronic
1106373626 13:29162139-29162161 TGGTGTTCTTATAATAAGGGGGG - Intronic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1107090583 13:36474745-36474767 TTCTTTTCTTCTCTTAAGTTTGG + Intergenic
1107524127 13:41213603-41213625 TTGTGTCCGTCTCTTCAGGATGG + Intergenic
1108973097 13:56401869-56401891 TTGTGTGCTTCTCTTCAGCATGG - Intergenic
1109336612 13:61003063-61003085 TTGTGTTCTTTCCTTCAGGTTGG + Intergenic
1111449192 13:88391506-88391528 ACGTGTTCTTCTCTTTAGGGTGG - Intergenic
1111602416 13:90492091-90492113 TGGTGTACTTCTCTTTTGGGTGG + Intergenic
1112493159 13:99884959-99884981 TTGTGTCCTTCTATTCAGGTAGG + Intronic
1112691427 13:101899548-101899570 TTATGTTCTTTGCTTTAGGGTGG - Intronic
1112715205 13:102176711-102176733 TTGTGTTTTTCTATTATGGTAGG - Intronic
1112940534 13:104855668-104855690 TTGTGTCCTTCACTTTAGGGTGG - Intergenic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1114876615 14:26727746-26727768 TTGTGATCTTTTATTAAGCGTGG + Intergenic
1116021553 14:39468449-39468471 TTGTGTCCTTTCCTTCAGGGCGG + Intergenic
1116192668 14:41680192-41680214 TTGTGTTCTTCCATTCAGGGTGG - Intronic
1116339952 14:43709614-43709636 TTTTGTTCTTCTCATAGAGGAGG + Intergenic
1116481159 14:45392575-45392597 TTGTGTTCTTCCCTTCAGGATGG - Intergenic
1116500259 14:45612400-45612422 ATGTGTTTTTCTCTTAGGGATGG + Intergenic
1116766033 14:49071140-49071162 TTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1116957304 14:50937882-50937904 TTGTGTTTTTATGTTAAGTGAGG - Intronic
1117101599 14:52354317-52354339 CTGTGTTTTACTCATAAGGGAGG - Intergenic
1117110432 14:52447343-52447365 CTGTGTTCTTCCCTTTAGGATGG - Intronic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1118862663 14:69676835-69676857 TTCGGTTCTTCTCTTCAGGCAGG - Intronic
1119679994 14:76585075-76585097 TTGTGGGCTTCCCTTAAGAGTGG - Intergenic
1120283749 14:82471295-82471317 TTTTGTTCTATTCTGAAGGGTGG + Intergenic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1120578678 14:86217835-86217857 TTGTATAATTTTCTTAAGGGCGG - Intergenic
1202871660 14_GL000225v1_random:170562-170584 TTGGGTATTTTTCTTAAGGGAGG - Intergenic
1124128533 15:26963256-26963278 TTGTATTCTTAGCTTAAAGGGGG + Intergenic
1125044409 15:35230087-35230109 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1125910139 15:43430125-43430147 TTGTTTCCTTCCCTTAATGGTGG - Intronic
1125966441 15:43879299-43879321 GTGAGATCTTCTGTTAAGGGAGG - Intronic
1126015749 15:44348588-44348610 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1126053235 15:44706821-44706843 TTATGTCCCTCTCTTTAGGGTGG + Intronic
1126291949 15:47091064-47091086 TTGTGTTGTACTGTTGAGGGAGG - Intergenic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1127521019 15:59743011-59743033 TTCTGTGCTTATGTTAAGGGTGG - Intergenic
1127661290 15:61102366-61102388 TTCTTTTGTTCTTTTAAGGGAGG - Intronic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1129642483 15:77394205-77394227 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1130402600 15:83571575-83571597 TTCTGTTTTTTTTTTAAGGGAGG + Intronic
1130441072 15:83955084-83955106 TTATGTTCTTCCCTTCAGGGAGG + Intronic
1131944990 15:97609634-97609656 TTGTGTTCTTCCTTTCATGGTGG - Intergenic
1137028192 16:35499054-35499076 TTTTGTTCTTCTCATACTGGAGG - Intergenic
1138879000 16:60988019-60988041 TTTCCTTCTGCTCTTAAGGGTGG + Intergenic
1138981342 16:62272627-62272649 TTGTGTTTTGTTTTTAAGGGAGG + Intergenic
1139611321 16:68061048-68061070 TTGTGTGTTTCTCCTTAGGGAGG + Exonic
1140292639 16:73675335-73675357 TTTTTTTCTTCTATTTAGGGAGG - Intergenic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1146750001 17:35369539-35369561 CTGTGTTCTTTTCTTCAGAGTGG - Intronic
1147916089 17:43887460-43887482 TTTTGTTTTTTTTTTAAGGGAGG + Intronic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149670232 17:58401552-58401574 TTGTTTTGTTTTCTAAAGGGAGG - Intronic
1149705961 17:58695198-58695220 AAGTGTTCTCCTTTTAAGGGTGG + Intronic
1149906322 17:60529377-60529399 GTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1150550446 17:66204684-66204706 TTGTGTCCCTCCCTTCAGGGTGG - Intergenic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155597373 18:27503069-27503091 TTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1156094329 18:33510834-33510856 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1156317016 18:35978971-35978993 TTCTTATCTTCTCTGAAGGGTGG + Exonic
1156351895 18:36309122-36309144 TTGGGGTCTTCTCTTATGGAGGG + Intronic
1156356558 18:36346937-36346959 TTCTGTTGTTTTCTTTAGGGTGG - Intronic
1156912307 18:42425575-42425597 TTGTGTGCTTCCCTTTAGGATGG + Intergenic
1157744095 18:50119655-50119677 ATGTCTCCTTCTCCTAAGGGAGG + Intronic
1157899087 18:51496618-51496640 TTGTGTTTTTCTCTAGAGCGGGG + Intergenic
1157905587 18:51567131-51567153 TTGCTTTTTTCTCTAAAGGGTGG + Intergenic
1158397472 18:57090408-57090430 TTGTTTTATGCTCTTAAGGTTGG - Intergenic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159260284 18:66004808-66004830 TTGTGTTCTTCTCTTCAGGGCGG - Intergenic
1159768077 18:72514706-72514728 TTGTCTTCTTGTTTTATGGGGGG - Intergenic
1159802501 18:72919160-72919182 TTGTGTTCTACCCTTCAGTGTGG + Intergenic
1162692940 19:12449028-12449050 TTGTTTCCTTCCCTTCAGGGTGG + Intronic
1162871195 19:13588033-13588055 TTTCTTTCTTTTCTTAAGGGAGG - Intronic
1163825669 19:19523281-19523303 TTTTGGTCTTCTCTTAAGAATGG + Intronic
1164291785 19:23876317-23876339 TTGTCTTCTTCTTTTGTGGGTGG - Intergenic
1164324062 19:24177525-24177547 TTGTCTTCTTCTTTTGTGGGTGG - Intergenic
1166150723 19:40873261-40873283 TTTTGTTCTTCCCTTTGGGGTGG - Intronic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
1167083223 19:47291343-47291365 TTGTGTTCATTTCTTCAGGATGG - Intronic
1167929726 19:52854392-52854414 TTGTGTCATTGTGTTAAGGGAGG - Intronic
926602115 2:14855847-14855869 CTGTGTTCTTTCCTTTAGGGTGG - Intergenic
926989845 2:18666717-18666739 TCGTCTTCTTGTCTCAAGGGTGG + Intergenic
927309710 2:21616989-21617011 CTGTGTCCTTCACTTCAGGGTGG + Intergenic
928466805 2:31529773-31529795 TTGTTTTGTTCTGTTAAGGAAGG + Intronic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
928802984 2:35116257-35116279 CTGTGTCCTTTTCTTTAGGGTGG - Intergenic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
929735566 2:44545191-44545213 TTGTGTCCTGCTCTTAGGAGAGG + Intronic
930288777 2:49467560-49467582 TTGTGTCCTTCGCTTCAGGGTGG + Intergenic
931133287 2:59364357-59364379 TTATGTTACTCTCTTAAGCGAGG + Intergenic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
932648720 2:73532310-73532332 TTGTGTGCTTTCCTTCAGGGTGG + Intronic
933077825 2:77951697-77951719 TTGTGTACTTCACTTAAGGGTGG - Intergenic
933091581 2:78125962-78125984 TTGTGTGCTGCTTTTAAGGAAGG - Intergenic
934755904 2:96824713-96824735 TTGTGTTCTCCACTGGAGGGAGG + Intronic
934931019 2:98423429-98423451 TTATTTTCTTCTCTTAAAGTAGG - Intergenic
935194167 2:100802073-100802095 TTGTTTTTCTCTCTTACGGGTGG - Intergenic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
936925424 2:117731519-117731541 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
938475491 2:131607560-131607582 TTGTGTTCTTCCTTTAAAGAAGG + Intergenic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
939029846 2:137059112-137059134 TTGTCTTCTTGTCTTAAAGATGG + Intronic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
941678688 2:168371673-168371695 TTGAGTCTCTCTCTTAAGGGTGG - Intergenic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
941805517 2:169708215-169708237 TTGTGGTTTTCTTTTAAGTGGGG + Intronic
942391708 2:175502187-175502209 TTGTGTTCTTCCCTTCAGGTTGG + Intergenic
942750152 2:179277538-179277560 CTGTGTTCCTCCCTTCAGGGTGG - Intergenic
942769168 2:179495433-179495455 CTGTTTTCTTCCCTTTAGGGCGG - Intronic
943427810 2:187758740-187758762 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
944046253 2:195414663-195414685 TTGTATCCTTCTGTTAAGGGTGG - Intergenic
944760459 2:202808532-202808554 TTGTGTCGTTCTCTTCAGGGTGG - Intronic
944854995 2:203759270-203759292 TTGTGTCTTTTTCTTCAGGGAGG + Intergenic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
945532009 2:210967394-210967416 TTGTGTTTGTTTCTTAAGTGTGG + Intergenic
945551821 2:211229658-211229680 TTGTGTTCTTCCTTTTAGGATGG - Intergenic
945739682 2:213644923-213644945 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
948774752 2:240278294-240278316 TTGTGTCCTTCCCTTATGGGTGG - Intergenic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1170995928 20:21358811-21358833 TTGTGCTCTTTTGTTAAGGGTGG + Intronic
1174552108 20:51369549-51369571 TTTTCTTCTTCTTTTAAGGCAGG - Intergenic
1176899410 21:14420889-14420911 CTGTGTTCTTCCCTTCAGTGTGG - Intergenic
1177222162 21:18209088-18209110 TTGTATTCTTTTCTTCAGGATGG + Intronic
1177771394 21:25519788-25519810 TTGTGTTCTTCCCTTTAGGGTGG - Intergenic
1178007317 21:28235584-28235606 TTATGTTCTTCCCTTCAGGGCGG - Intergenic
1178098086 21:29236917-29236939 CAGTCTTCTTCTTTTAAGGGTGG - Intronic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1181837585 22:25623593-25623615 TTGTGTTTTTCTGGTCAGGGAGG - Intronic
1182152881 22:28042804-28042826 TTGGGTTCTTCTCCTATGTGAGG - Intronic
1184331017 22:43828021-43828043 TTTTGTTCTTCTCTGAAAAGGGG - Intronic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951279466 3:20731112-20731134 TTGTGTTCTTCCCTTCAGGGTGG + Intergenic
951436898 3:22675969-22675991 TTGTGTACTTCTCTTCAGGGTGG + Intergenic
951659956 3:25052179-25052201 TTGTGCTCTTCTCCTCAGGATGG - Intergenic
952139750 3:30465685-30465707 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
954590911 3:51780851-51780873 TTGTGTGCTTTTCTTAAAGTAGG + Intergenic
955384007 3:58464305-58464327 TTTTGTTCTTATATTTAGGGAGG + Intergenic
956757235 3:72400926-72400948 CTATTTTCTTCTTTTAAGGGAGG - Intronic
956763729 3:72466242-72466264 TTGTGTTCTGTTCACAAGGGAGG + Intergenic
957949909 3:87111172-87111194 TTGTGTTCCTTTCTTAAAGATGG + Intergenic
958435474 3:94090635-94090657 TTTAGTTATTTTCTTAAGGGGGG - Intronic
959042003 3:101432367-101432389 CTGTGTTCTTCCCTTCAGGATGG - Intronic
959113532 3:102149371-102149393 TTGTGTCCTTCCATTCAGGGTGG - Intronic
959189790 3:103097037-103097059 CTGTGAACTTCTCTTCAGGGCGG + Intergenic
959408983 3:105997326-105997348 TTGTTTTCTTCCCTTTAGGGTGG + Intergenic
959547360 3:107612812-107612834 TTGTGTCCTTCTGTTCAGGGTGG + Intronic
959717108 3:109444737-109444759 CTGTGTTCTTCTCTTCAGAGTGG - Intergenic
959841722 3:110984132-110984154 TTGTGTCCTTCTCTTCAGCGTGG - Intergenic
960404231 3:117239275-117239297 CTGTGTCCTTCTCTTCAGGTTGG - Intergenic
960942917 3:122946268-122946290 CTGTGGGTTTCTCTTAAGGGGGG - Intronic
962015234 3:131432171-131432193 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
962153542 3:132919023-132919045 ATGTGATTTTCTCTAAAGGGTGG + Intergenic
962698931 3:137978505-137978527 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
964964985 3:162481489-162481511 TTGTTTCTTTCTTTTAAGGGTGG + Intergenic
965002855 3:162979828-162979850 TTTTTTTTTTCTTTTAAGGGTGG - Intergenic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
965526981 3:169731170-169731192 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
965630965 3:170732229-170732251 TTTTGTTCTTCTCTTCAGATGGG + Intronic
965844598 3:172946770-172946792 TTGCGTCCTTCCCTTCAGGGTGG - Intronic
966151188 3:176869092-176869114 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
967908574 3:194522223-194522245 TTTTGTTTTTTTTTTAAGGGAGG - Intergenic
968096228 3:195932673-195932695 TTGTGTCTTTCTTTTCAGGGCGG - Intergenic
969401254 4:6957073-6957095 CTGTGTGCTCCTCTTGAGGGTGG + Intronic
970413337 4:15832794-15832816 CCGTGTTCTTCTCTTCAGGTTGG + Intronic
971543524 4:27853821-27853843 TTGTTTTCTTCTCCTCAGGTGGG - Intergenic
971612100 4:28738658-28738680 TTGTGGACTTCACTTAAGGGAGG - Intergenic
971891540 4:32529816-32529838 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
972150090 4:36078566-36078588 TTCTGTGTTTATCTTAAGGGAGG + Intronic
972579336 4:40380723-40380745 TTGTGTTCTTCCCTTCAAGGTGG - Intergenic
973162350 4:47033072-47033094 TTGTATTGTTCTCTTGCGGGAGG + Intronic
973188685 4:47362037-47362059 TTATGCTCTTCTCTCAAGGTTGG - Intronic
973919723 4:55673077-55673099 TTGTGTCCTTCCCTTCAGAGAGG + Intergenic
975333775 4:73151658-73151680 TTGTGTTCTACAATTGAGGGTGG - Intronic
976016501 4:80560891-80560913 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
976286692 4:83377376-83377398 TTCTTATCTTCTCTGAAGGGTGG - Intergenic
976583260 4:86765377-86765399 TTGTCTTTTTCTCTTTAGGGAGG + Exonic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977397295 4:96486646-96486668 CTGTTTTCTTGTCTTAGGGGTGG - Intergenic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979213205 4:118132131-118132153 TTGTGTCCTTCCCTTCAGAGCGG + Intronic
979213719 4:118137512-118137534 GTGTGTGCTTCTCCTAAGGCAGG + Intronic
979568726 4:122189159-122189181 TTGTATTTTTCACTTAAGTGTGG + Intronic
979573071 4:122252729-122252751 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
980597005 4:134967185-134967207 TTGTGTCTTTCTTTTCAGGGAGG - Intergenic
980844246 4:138304743-138304765 TTGAGTTGTTTTCATAAGGGTGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
981394773 4:144234461-144234483 TTGTGTTTTTCCCTTGAGGGTGG - Intergenic
982719826 4:158848065-158848087 TTGTGTCCTTCCCTCAAAGGTGG - Intronic
982918482 4:161244798-161244820 TTCTGCTCTTCTCTTCATGGAGG + Intergenic
983017307 4:162628922-162628944 TTTTGTCCTTCCCTTTAGGGTGG - Intergenic
983599448 4:169509090-169509112 TTGTGTTAGTCACTTAAGAGGGG + Intronic
983683897 4:170385126-170385148 TTGTGTTGTTCTCATCAGGATGG + Intergenic
984907206 4:184639663-184639685 TTGTTTTCCTCTATTTAGGGAGG - Intronic
986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG + Intergenic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
987631540 5:20478681-20478703 TTGTGTCCTACCCTTCAGGGTGG - Intronic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
988381568 5:30503209-30503231 TTGTCTTGTTGTCTCAAGGGTGG + Intergenic
988939424 5:36127830-36127852 TTTTGTTCTTCCCTTCAGAGTGG - Intronic
989013993 5:36907539-36907561 TTGTTTTCTTTACTTAAGGTGGG - Intronic
989970669 5:50520962-50520984 TCGTGTCCTTCCCTTCAGGGTGG + Intergenic
990161802 5:52949294-52949316 TTATGTTCTTCACTTAAAAGAGG - Intronic
990578900 5:57149974-57149996 TTGTGTTTTTCCCTTCAGGGTGG + Intergenic
990933041 5:61114979-61115001 TTGTATTCTTTTCTTCAGGGAGG + Intronic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
991418015 5:66411456-66411478 CTGTGTTCTTCTCTGGAGGCTGG - Intergenic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
992587245 5:78252806-78252828 CTGTGTCCTTCCCTTAAGGGTGG - Intronic
993175823 5:84483811-84483833 TTGTCTTATTCCCTTAATGGTGG - Intergenic
994207966 5:97057213-97057235 TTGGTTTCTTCTTTTGAGGGAGG + Intergenic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
994660084 5:102642434-102642456 TTGTGTCTATCTCTTTAGGGTGG - Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
995019521 5:107351613-107351635 TTGTGTCTTTCCCTTAGGGGTGG + Intergenic
995096444 5:108240635-108240657 TTGTATCCTTCCCTTCAGGGTGG - Intronic
995146832 5:108796442-108796464 TTGTGTCCTTTCCTCAAGGGTGG + Intronic
995697720 5:114899152-114899174 TTGTCTCCTTCCCTTCAGGGTGG + Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996129107 5:119759611-119759633 ATGTGAGCTTCCCTTAAGGGAGG + Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
997832740 5:137164995-137165017 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
999002448 5:147939321-147939343 TTATATTATTCTCTTCAGGGTGG + Intergenic
999514363 5:152286045-152286067 TTATGTTGGTCTCTGAAGGGTGG + Intergenic
999678462 5:154031397-154031419 TTGTTTTCTTCCTTTAAAGGGGG - Intronic
1000342778 5:160290109-160290131 TTGGTTTCTTCTATTAGGGGAGG + Intronic
1001014645 5:168129042-168129064 TGGTGTCCTTTTCTTAATGGGGG - Intronic
1001938389 5:175723516-175723538 CTGTGTTCTTCTCTTATCTGGGG - Intergenic
1004742221 6:18473033-18473055 CTGTGTTCTCCTCTGGAGGGAGG + Intergenic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1008215170 6:48779054-48779076 CAGTGTTCTTCTCTTCAGGGTGG - Intergenic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1008731704 6:54491088-54491110 TTGTGTTTTCCTCTTCAGGGTGG + Intergenic
1008940600 6:57041419-57041441 TTGTTTCCTTCCCTTCAGGGTGG - Intergenic
1009353342 6:62709009-62709031 TTGTGTCTTTCCCTTAAGTGTGG + Intergenic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010343296 6:74782013-74782035 TTGTATACTTCCCTTCAGGGTGG - Intergenic
1011019037 6:82789832-82789854 TTGTGTTCTTCCCTTCATGGAGG - Intergenic
1011033282 6:82945041-82945063 TTGTGTTCTTCCCTTCAGGGTGG - Intronic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1011386204 6:86801457-86801479 TTGTGTCTTTCCCTTGAGGGTGG + Intergenic
1011901413 6:92302626-92302648 CTGTGTTCTTCACTTTAGGGTGG - Intergenic
1012691799 6:102322907-102322929 TTATTTTCTTCTCTTTAGGCAGG + Intergenic
1012714355 6:102649447-102649469 CTGTGTCCTTCTCTTTAGTGTGG - Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1013687533 6:112602110-112602132 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1014667888 6:124261916-124261938 TTGTTTTTTTCTCTTCAGGCTGG + Intronic
1014840723 6:126217816-126217838 TTGTGTCCTTCCTTTCAGGGCGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1014928466 6:127303971-127303993 CTGTGTTCTTCCCTGCAGGGTGG - Intronic
1015030390 6:128587208-128587230 CTGTGTCCTTTTCTTCAGGGTGG - Intergenic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1016290286 6:142521680-142521702 TTGTGAGCTTCTCTTCAGGAGGG + Intergenic
1016463156 6:144299819-144299841 TAGTTTTCTTATCTTAAGGGGGG + Intronic
1016527771 6:145021745-145021767 TTTTGATATTCTCTTGAGGGAGG + Intergenic
1017265641 6:152442315-152442337 TTCTGTACTTCTGTTAAGCGTGG - Intronic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1017424030 6:154302471-154302493 TTCTTTTCTTCTCTTTAGTGGGG + Intronic
1018978778 6:168585467-168585489 TTTTGTTTTTCTCTTTAGGTTGG + Intronic
1019138291 6:169926139-169926161 TTATGTTGTTCTCTTCAGGAGGG - Intergenic
1020574736 7:9912741-9912763 TTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1021034876 7:15785375-15785397 TAGTGTCCTTCCCTTTAGGGTGG - Intergenic
1021214513 7:17900380-17900402 TTGTGTCCTTCCCTTCAAGGTGG + Intronic
1022541945 7:31145899-31145921 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1023174262 7:37420435-37420457 TTGTGTTATTTTCATAAAGGGGG + Intronic
1023552314 7:41383337-41383359 TGATGTTCTTGTCTGAAGGGGGG + Intergenic
1024044983 7:45579978-45580000 TTTTGTTTTTCTCGTAGGGGTGG + Intronic
1024170265 7:46777901-46777923 CTGGGTTCTTCTCTTCAAGGGGG - Intergenic
1024192185 7:47024017-47024039 CCGTGTTCTTCTCCTAAGGTGGG - Intergenic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1024861455 7:53847271-53847293 TTTTTTTCTTCTTTTAAGGATGG + Intergenic
1028037134 7:85999123-85999145 TTGTGTCCTTCCCTTAATAGCGG + Intergenic
1028161009 7:87484324-87484346 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1029872659 7:103711540-103711562 TTCTTTTCTTCTCTTAAGGCAGG + Intronic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030488574 7:110203595-110203617 TTGTGTTCTTCCCTTCAGGATGG + Intergenic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031288293 7:119900403-119900425 TTGTGTTCTTCCCTTAGAGGTGG + Intergenic
1031509176 7:122626987-122627009 TTGTGTTGTTCTGTGAAGTGTGG + Intronic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1033898715 7:146109404-146109426 TTTTATTCTTCTATCAAGGGAGG + Intergenic
1034126488 7:148676109-148676131 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034366904 7:150558247-150558269 TTGTGTTTTTATATTAAGAGTGG - Intergenic
1034990990 7:155548165-155548187 TTGTCTCCCTCTCGTAAGGGTGG - Intergenic
1035959331 8:4119580-4119602 TAGTGTTCTTCTATCTAGGGAGG + Intronic
1036828804 8:12003701-12003723 TTGTCTTCTCCTCTTAAAGCCGG - Intergenic
1036834032 8:12043654-12043676 TTGTCTTCTCCTCTTAAAGCCGG - Intergenic
1037295719 8:17397649-17397671 ATGTGTCCTTCCCTTCAGGGTGG - Intronic
1038186990 8:25284174-25284196 TTCTTTTCTTCTCTTAAGTGGGG + Intronic
1039794493 8:40900861-40900883 TTCTCTTATTTTCTTAAGGGGGG - Intergenic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1044532942 8:93328715-93328737 TACTGTTCTTTGCTTAAGGGTGG - Intergenic
1044641367 8:94385337-94385359 TTTTTTTTTTCTCTGAAGGGTGG - Intronic
1044839729 8:96327428-96327450 TTCTGTTCTTCTTTAAAGGGAGG - Intronic
1045159556 8:99523292-99523314 TTGTGTCCTTCCCTTCAGAGTGG - Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045621297 8:103981005-103981027 TTGGGTACTTCTCTTCGGGGTGG - Intronic
1046471019 8:114674261-114674283 CTCTATTCTTCTCTTAAGGCAGG - Intergenic
1049087903 8:140492427-140492449 TTCTGTTCTTCTTTTATGGCTGG + Intergenic
1050471745 9:5999925-5999947 CTGTGTCCATCCCTTAAGGGAGG + Intronic
1051384411 9:16492146-16492168 TTTTGTTTTTTTTTTAAGGGTGG - Intronic
1051646130 9:19270327-19270349 TTGTGTTTTTCCCTTCAGGGTGG + Intronic
1053904878 9:42831583-42831605 TTGTTTTCTGCTCTTTGGGGTGG + Intergenic
1054723746 9:68629425-68629447 ATGTGTTTTTTTCTTTAGGGTGG + Intergenic
1054982663 9:71223966-71223988 TTGTGTTCTTCCCTTTAGGGTGG - Intronic
1055286327 9:74732030-74732052 TTGTATTCTTCTATTAAAGGTGG - Intronic
1055302133 9:74892613-74892635 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1055756561 9:79564670-79564692 TTGTGTTTTATCCTTAAGGGAGG - Intergenic
1056047662 9:82735606-82735628 ATGTTTTCTTCTCTTAAGCAAGG - Intergenic
1057945349 9:99323127-99323149 TTGAGTTCTATTCTTACGGGGGG - Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1059886678 9:118751895-118751917 TTGTGTCCTTCCCTTTAGGATGG - Intergenic
1060573966 9:124671693-124671715 TTGTGTTAGTCACTTAAGAGTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203732788 Un_GL000216v2:106037-106059 TTGGGTATTTTTCTTAAGGGAGG + Intergenic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1188269878 X:28126017-28126039 TTGTGGTTTTTTCTTGAGGGAGG + Intergenic
1188421047 X:29991395-29991417 TTATGTTCTTCTCTTTAGGGTGG + Intergenic
1188815242 X:34705202-34705224 CTGTGTTCTTCACTTCAGGGCGG + Intergenic
1188846227 X:35076072-35076094 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1189593926 X:42544050-42544072 TTGCATTCTTCTATTCAGGGTGG - Intergenic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1189640862 X:43068690-43068712 TTGTGTTCTTTCCTTCAGGATGG - Intergenic
1189690487 X:43612686-43612708 CTGTGTTCTTCCCTTTAGGGTGG + Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1190037894 X:47042779-47042801 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1190368209 X:49717184-49717206 TTGTGTCCTTTCCTTCAGGGTGG + Intergenic
1190374262 X:49774199-49774221 TTGTGTTCTTTCCTTCAGGGTGG + Intergenic
1190650031 X:52559912-52559934 CTTTGTTCTTCTCTTGAAGGAGG - Intergenic
1191974049 X:66850990-66851012 GTGTGTTCTTCCCTTCAGAGTGG + Intergenic
1192694540 X:73400201-73400223 TTATGTTATTCTCTCCAGGGTGG - Intergenic
1192891001 X:75390291-75390313 TTCTGTTCTTCCCTTCTGGGTGG - Intronic
1193213977 X:78840514-78840536 TTGTGTCCTTCCATTCAGGGTGG - Intergenic
1193305860 X:79950199-79950221 TTGTGCTCTTCTTTTCAGGATGG - Intergenic
1193366172 X:80636991-80637013 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193417151 X:81238571-81238593 CTGTGTTCTTCTCCTCAGTGTGG - Intronic
1193578440 X:83232281-83232303 ATGTGTTCTTCACTTTAGTGTGG - Intergenic
1193676148 X:84454653-84454675 TTGTGTCCTTTTCTTCAGGATGG - Intronic
1193742422 X:85232870-85232892 TTGTGTTTTTCCCTTCAGGATGG - Intergenic
1193760825 X:85463097-85463119 CGGTGTTTTTCCCTTAAGGGTGG - Intergenic
1193821420 X:86170411-86170433 TTGTGTTCTTCCCTTCAGGACGG + Intronic
1193911912 X:87316612-87316634 TTATGTCCTTGTCTTCAGGGTGG + Intergenic
1194526563 X:94984089-94984111 TTGTGTCCTTCCCTCCAGGGTGG - Intergenic
1194561639 X:95428536-95428558 TTGTGTTTTTCCCTTCAGAGTGG - Intergenic
1194608989 X:96017445-96017467 TTTTGTTTTTCTCCTGAGGGAGG - Intergenic
1194885204 X:99306651-99306673 TTTTTTTGTTCTCTTAAGTGGGG + Intergenic
1194945088 X:100057501-100057523 TGGTTTTCTTCTATTAAGGTGGG - Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1195601364 X:106752134-106752156 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196232396 X:113239593-113239615 TTGTGTTCTTCCCTTTAGAGTGG + Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196579098 X:117358824-117358846 CTGTATTCTTCCCTTCAGGGTGG + Intergenic
1196590900 X:117484446-117484468 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197382696 X:125765215-125765237 TTGTATCCTTCTCTTCAGGGTGG + Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197470074 X:126856194-126856216 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1197527668 X:127582556-127582578 CTGTGCTCTTCACTTCAGGGTGG + Intergenic
1197623463 X:128778603-128778625 TTGTGTTCTTCTCTTCAGGGTGG + Intergenic
1198512341 X:137365112-137365134 TTGTGTTCTTCTCCTGACAGAGG + Intergenic
1198964558 X:142214248-142214270 TTGTGTCCTTCCCTTTACGGTGG + Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1199173671 X:144759262-144759284 CTGTTTCCTTCTCTTAATGGTGG - Intergenic
1199334258 X:146600151-146600173 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1199393810 X:147310828-147310850 TTCTTTTCTTCTCTTAACGTTGG - Intergenic
1199431005 X:147760004-147760026 TTCTGTTCTTCTTTGATGGGAGG - Intergenic
1199455113 X:148019974-148019996 TTGTATCCTTCCCTTCAGGGTGG + Intronic
1199457315 X:148043803-148043825 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1200107129 X:153720727-153720749 CTGTGTCTTTCTCTTGAGGGAGG - Intronic