ID: 918021498

View in Genome Browser
Species Human (GRCh38)
Location 1:180697025-180697047
Sequence CTCAAGCTATTCCAAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 4, 2: 16, 3: 68, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918021498_918021502 12 Left 918021498 1:180697025-180697047 CCAGTTTTTTGGAATAGCTTGAG 0: 1
1: 4
2: 16
3: 68
4: 344
Right 918021502 1:180697060-180697082 TAGTTATTTACAGGTTTGGTAGG 0: 1
1: 0
2: 4
3: 20
4: 172
918021498_918021501 8 Left 918021498 1:180697025-180697047 CCAGTTTTTTGGAATAGCTTGAG 0: 1
1: 4
2: 16
3: 68
4: 344
Right 918021501 1:180697056-180697078 TTGTTAGTTATTTACAGGTTTGG 0: 1
1: 0
2: 1
3: 28
4: 297
918021498_918021500 3 Left 918021498 1:180697025-180697047 CCAGTTTTTTGGAATAGCTTGAG 0: 1
1: 4
2: 16
3: 68
4: 344
Right 918021500 1:180697051-180697073 AATTATTGTTAGTTATTTACAGG 0: 1
1: 0
2: 3
3: 37
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918021498 Original CRISPR CTCAAGCTATTCCAAAAAAC TGG (reversed) Intronic
901110431 1:6789023-6789045 CCCAACCTAGTCCCAAAAACTGG - Intronic
904638069 1:31900043-31900065 CTCAAGCTATTTTAAACAAGGGG + Intergenic
905073841 1:35251974-35251996 CTCAAACTCTTCTAAAAAATTGG - Intergenic
906836597 1:49089692-49089714 CTGAAACTATTCCAAAAAATTGG + Intronic
908512991 1:64864280-64864302 CTCAAGTGATACCAAAAAAGAGG + Intronic
909403950 1:75265202-75265224 TTCAAACTATTCCAGAAAATTGG + Intronic
909841695 1:80335589-80335611 CTCAAACCATTCCAAACAATAGG + Intergenic
910407241 1:86901752-86901774 CTAAAATTATACCAAAAAACTGG + Intronic
910597670 1:88996685-88996707 CTCAACAAATTGCAAAAAACTGG + Intergenic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
912280451 1:108307793-108307815 CTCAAGTTCTTTCAAATAACTGG - Intergenic
912287775 1:108386564-108386586 CTCAAGTTCTTTCAAATAACTGG + Intronic
912506966 1:110163057-110163079 CTCAAGCTATTCCAAACATGAGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
912627580 1:111218827-111218849 CACTAGATATACCAAAAAACAGG - Intronic
913663420 1:121025509-121025531 CTAAAACTATTCCAAAAAATTGG + Intergenic
913959083 1:143325705-143325727 CTCAAACTATTTTGAAAAACAGG + Intergenic
914014811 1:143808777-143808799 CTAAAACTATTCCAAAAAATTGG + Intergenic
914053400 1:144151085-144151107 CTCAAACTATTTTGAAAAACAGG + Intergenic
914125797 1:144815456-144815478 CTCAAACTATTTTGAAAAACAGG - Intergenic
914163010 1:145152430-145152452 CTAAAACTATTCCAAAAAATTGG - Intergenic
914653432 1:149717334-149717356 CTAAAACTATTCCAAAAAATTGG + Intergenic
915043368 1:152987630-152987652 CTCAAACTATTTCAGAAAATTGG + Intergenic
915810795 1:158908107-158908129 CTGAAACTGTTCCAAAAATCTGG + Intergenic
917073393 1:171177538-171177560 CCAAAGCTCTCCCAAAAAACAGG - Intergenic
917449512 1:175135428-175135450 CTCAAACTATTTCAGAAAAGGGG + Intronic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
920027519 1:203010492-203010514 GTCAAGATATTCCAAAATGCGGG + Intronic
922302963 1:224319264-224319286 CTCAAATTATTCCCAAAAAATGG + Intronic
922392311 1:225157325-225157347 CTCAACTAATTCCAAAAAAGTGG + Intronic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1063881008 10:10532101-10532123 CTCAAGTTCTTTCAAAAGACAGG + Intergenic
1064143506 10:12809388-12809410 ATCTAGCAATTCCAAAAAAATGG + Intronic
1065260168 10:23915652-23915674 CTATAGCTATTCCAAAACAAAGG + Intronic
1066014892 10:31231444-31231466 CTGAAACTATTCCAAACAATTGG + Intergenic
1066110972 10:32196568-32196590 CTCAAACTCTTTCAAAAAAATGG - Intergenic
1066963028 10:42237859-42237881 CTCAAACTATTTTGAAAAACAGG + Intergenic
1068055559 10:52008731-52008753 TTGAAACTGTTCCAAAAAACTGG - Intronic
1068493432 10:57753985-57754007 CACAAGGCATACCAAAAAACTGG - Intergenic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1069050871 10:63792211-63792233 CTCAAACTACTGCAAAAAATAGG + Intergenic
1069072318 10:64001923-64001945 CTGAAACTACTCCAAAAAATTGG + Intergenic
1070073658 10:73114371-73114393 TGCAAGCTATTCCACAATACAGG - Exonic
1070483742 10:76910370-76910392 CTAAAGCTATGCCAAAGGACTGG - Intronic
1070632868 10:78100252-78100274 CTGAAACTATTCCAAACAATAGG + Intergenic
1070870881 10:79751568-79751590 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071637807 10:87273779-87273801 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071657437 10:87464171-87464193 TAAAAACTATTCCAAAAAACTGG - Intergenic
1072182122 10:92995251-92995273 CACAGGCTATTCCAGAAACCTGG - Intronic
1072380354 10:94862467-94862489 CTCAAAAGATTCCAAGAAACAGG + Intergenic
1076269490 10:129139046-129139068 TTCAAGATATTCAAAAAAATCGG - Intergenic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1077963261 11:7098050-7098072 TTCAAGATATTCCATGAAACAGG + Intergenic
1078299815 11:10117070-10117092 TTCAAGCTAGTCAAAAAACCAGG + Intronic
1079270457 11:18980414-18980436 GTCAACCTAATACAAAAAACAGG - Intergenic
1079458315 11:20656619-20656641 CACAAGCTACTCTTAAAAACTGG - Exonic
1079814293 11:25036010-25036032 CTGAAACTATTCCAAAAAGCTGG - Intronic
1080083962 11:28256238-28256260 CTCAAACTATTCTAAGAAAGAGG - Intronic
1080205316 11:29722814-29722836 CACAAGATTTTCCAAAAATCTGG - Intergenic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1081058757 11:38446185-38446207 CTCATGTTTTTCCAAAACACAGG - Intergenic
1082865152 11:57892965-57892987 CTCAAACTATTCCAGAAAATTGG - Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1084373136 11:68758032-68758054 CTCAAGCGATTCCAAAGTGCTGG - Intronic
1085234596 11:75004351-75004373 CTCAAGCTATTCTAAAGTGCTGG + Intronic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1086430704 11:86733177-86733199 CACAAACTCTTCCAAAAAATAGG + Intergenic
1087077130 11:94135448-94135470 CTGAAGATATTCCCAAAGACAGG - Intronic
1087485167 11:98751433-98751455 CTGAAACTATTCCAAACAATAGG + Intergenic
1087853909 11:103067914-103067936 CATAAGCTTTTTCAAAAAACGGG - Intronic
1088899254 11:114102772-114102794 CTAGAGCTATTCCAGAAAAAAGG + Intronic
1089095559 11:115917397-115917419 TTCAAGCTTTTTCAAAGAACAGG - Intergenic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090814049 11:130274904-130274926 TACAAACTCTTCCAAAAAACGGG - Intronic
1091598153 12:1894332-1894354 CTCAAGTTATTCCAAAATATTGG + Intronic
1092085427 12:5754458-5754480 CTTAAAGTCTTCCAAAAAACAGG - Intronic
1093505917 12:19865558-19865580 CCCAAGCTACTCCAAAGACCTGG - Intergenic
1095298395 12:40553479-40553501 ATGAAACTATTCCAAAAAATTGG - Intronic
1095367654 12:41427261-41427283 GTGAAAATATTCCAAAAAACAGG - Intronic
1096346682 12:50853923-50853945 CTAAAACTATTCAAAAAAATTGG + Intronic
1096403392 12:51325245-51325267 CTCAAGCTATCCCCTCAAACAGG - Intergenic
1097235495 12:57536641-57536663 CTGAAGCTCTTCCAAAAACAGGG + Intronic
1097291453 12:57919617-57919639 CTCAAGCTAGTTCAAACAAAGGG + Intergenic
1097418866 12:59348922-59348944 CTGAAACTATTCCAAACAATAGG - Intergenic
1097753194 12:63380547-63380569 CTGAAACTATTCCAAACAATAGG + Intergenic
1099522344 12:83680443-83680465 CTCATGATATTCCACAACACAGG + Intergenic
1099849842 12:88079483-88079505 ATCAAGCTATTACAAAAAACAGG + Intronic
1100048626 12:90415801-90415823 CTCAAAATATGCCAGAAAACTGG - Intergenic
1100065530 12:90640006-90640028 GTTAAGCTAATCCAAACAACTGG + Intergenic
1101482656 12:105115591-105115613 CTCAATCAATACCAAAAAAGGGG - Intronic
1104262299 12:127195456-127195478 CTGAAATTATTCCAAAAAAGAGG + Intergenic
1105450198 13:20492746-20492768 CCAAAGCTATGCCAAAAATCTGG + Intronic
1108130541 13:47294967-47294989 CTGAAACTATTCCAAACAATTGG - Intergenic
1108135743 13:47356324-47356346 CTCAAACACTTCCAAAAAATTGG - Intergenic
1109120980 13:58456931-58456953 CTAAACCTATTCCAAAAATAGGG + Intergenic
1109346560 13:61121708-61121730 CTCAAACTTTTCCAAAAATTTGG + Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110422118 13:75323339-75323361 GTCAAGCTATACACAAAAACAGG + Intronic
1110647760 13:77907878-77907900 CCCAAGCTATCACAGAAAACAGG + Intronic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1110985377 13:81960628-81960650 CTGAAACTATTCCAAAACAATGG + Intergenic
1111344460 13:86932448-86932470 CTCAATGTAATCCAAAAAACTGG - Intergenic
1111521003 13:89404280-89404302 ATCATGCTATTCAAAACAACAGG - Intergenic
1111813456 13:93120601-93120623 CTCAAGAGAGTCCAAAATACTGG + Intergenic
1112619832 13:101043486-101043508 CTGAAGCTACTCCAAACAATAGG - Intergenic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1113169810 13:107487823-107487845 CTGAAACTATTCCAAAAAATGGG - Intronic
1114126050 14:19727165-19727187 CTGAAACTATTCCCAAAAATGGG - Intronic
1114544203 14:23486615-23486637 CACAAGATCTTCCTAAAAACTGG - Intronic
1115765842 14:36623070-36623092 CACAAACTCTTCCAAAAAATAGG - Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116193251 14:41687003-41687025 CTGAAACTATTCCAAACAATTGG - Intronic
1116274558 14:42814459-42814481 CTCAAACTCTTCCAAAAAAATGG - Intergenic
1116318209 14:43425459-43425481 CTGAAACTATTCCAAACAATAGG + Intergenic
1116549754 14:46221931-46221953 CTAAAAGTATTGCAAAAAACAGG + Intergenic
1116840130 14:49811962-49811984 CACAAACTCTTCCAAAAAATAGG - Intronic
1117502774 14:56370536-56370558 CTAAAACTATTCCAAAAAATTGG - Intergenic
1119309113 14:73631834-73631856 CACATGATATTCCAAGAAACAGG - Intergenic
1202929330 14_KI270725v1_random:24481-24503 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123422965 15:20146737-20146759 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123442037 15:20299576-20299598 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123532191 15:21153277-21153299 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123757624 15:23409103-23409125 CTCAATCTATTCTGAAAAACTGG - Intergenic
1123958682 15:25369925-25369947 CAGCAGCTATTCCAAAAATCTGG - Intronic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1127576608 15:60297888-60297910 CTGAAGTTCTTCCACAAAACTGG - Intergenic
1127763086 15:62159861-62159883 CTCAAGCTATTCTCAAAAAATGG + Intergenic
1130398612 15:83528934-83528956 CTAAAGCCAATCCAAAAAAATGG - Intronic
1131711798 15:95063596-95063618 CTCTAAGTATTCCATAAAACTGG + Intergenic
1135296867 16:21287309-21287331 CTCAAACTCTACCAAAAAATAGG - Intronic
1135332831 16:21575217-21575239 CTCAGGCTGTACAAAAAAACAGG - Intergenic
1136015297 16:27395353-27395375 CTCAAACTCCTCCACAAAACAGG + Intergenic
1136719176 16:32305941-32305963 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136724196 16:32344301-32344323 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136837547 16:33512205-33512227 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136842529 16:33550345-33550367 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136861783 16:33708603-33708625 CTCAAACTATTTTGAAAAACAGG - Intergenic
1137317862 16:47346856-47346878 CTCAGAGTATTCCAGAAAACTGG + Intronic
1138020504 16:53475510-53475532 CTCAAACTACTACAAAAAGCAGG - Intronic
1139111915 16:63902650-63902672 ATCCAGCTATTCCAAAGAAGTGG + Intergenic
1140946719 16:79775387-79775409 CCCAAGCTATTCCAGACAGCAGG - Intergenic
1140950405 16:79811481-79811503 CTCAAAATTTACCAAAAAACCGG + Intergenic
1141036941 16:80634923-80634945 CAAAAGCTGTTCCAGAAAACAGG + Intronic
1141052121 16:80777792-80777814 CATAAGCTATTCCTAAAAACAGG + Intronic
1203002236 16_KI270728v1_random:173464-173486 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203007255 16_KI270728v1_random:211830-211852 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203123279 16_KI270728v1_random:1556787-1556809 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203133839 16_KI270728v1_random:1709870-1709892 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203147730 16_KI270728v1_random:1812483-1812505 CTCAAACTATTTTGAAAAACAGG + Intergenic
1203152694 16_KI270728v1_random:1850642-1850664 CTCAAACTATTTTGAAAAACAGG + Intergenic
1144529474 17:16022190-16022212 CTCAAGCTACAACAAAAACCGGG + Intronic
1149675133 17:58453136-58453158 CTTAAACTATTCCAAAAAATTGG + Intronic
1150865800 17:68848558-68848580 CTTAAGCCATTGCAAAAAAATGG + Intergenic
1152553771 17:81042980-81043002 CTCAAGCAATTCCAAGAAGCTGG + Intronic
1153268050 18:3290841-3290863 CTCAAACTATTCTGAAAAATAGG - Intergenic
1153493398 18:5672833-5672855 CTAAAGCTATTACAAAATCCTGG + Intergenic
1153563755 18:6398677-6398699 CTCACACTATTCCAAAACCCAGG + Intronic
1153607226 18:6846725-6846747 CTGAAGCCTTTCCAAAAAATGGG + Intronic
1154230827 18:12554588-12554610 CTCAAACTATTCTGAAAAATAGG + Intronic
1154382337 18:13863812-13863834 CTCGAGCTAGTCAAAAAAAGAGG + Intergenic
1154407869 18:14111869-14111891 CTTAAACTATTCCAAAACAGAGG + Intronic
1155488807 18:26377219-26377241 CACAAGCTCTTCTAAAAAATAGG - Intronic
1155564671 18:27120844-27120866 CTCAGGGTTTTCCCAAAAACAGG + Intronic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1156896453 18:42252243-42252265 CTAAAAGTATTCCAAAAAATTGG - Intergenic
1159162162 18:64656460-64656482 CTGCAGCTCCTCCAAAAAACTGG - Intergenic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
1161285616 19:3466928-3466950 CTGTAGCTTTTCCAAGAAACAGG - Intronic
1162243228 19:9375388-9375410 CTCAAACTCTTCCAAAAAAATGG - Intronic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1163739989 19:19005605-19005627 CTCAAACTACTACAAAAAAGGGG + Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1164508013 19:28875192-28875214 CTCCAGCTATTTCAAGAAAAGGG - Intergenic
1166585690 19:43946198-43946220 CTGAAACTATTTCAAGAAACAGG - Intergenic
1167407306 19:49320958-49320980 CTCAAACTTTTCCAAAAAATTGG + Intronic
1202692798 1_KI270712v1_random:103508-103530 CTCAAACTATTTTGAAAAACAGG + Intergenic
925506516 2:4571320-4571342 CTCAACATTTTCCAAAAAATTGG - Intergenic
927138907 2:20116372-20116394 CTCCAGCTAATCCATAAAACGGG + Intergenic
927803148 2:26119974-26119996 CTAAAGCTTTTTTAAAAAACAGG + Intronic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
928988754 2:37208244-37208266 CTGAAACTATTCCAAAAGATAGG + Intronic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
931534017 2:63251883-63251905 CTGAAACTATTCCAAAAATCAGG + Intronic
932129247 2:69172933-69172955 CTCCAGTTACTCCAAATAACTGG + Intronic
933078261 2:77956093-77956115 CACAAACTAGTCCAAAAAATAGG + Intergenic
933617830 2:84501571-84501593 CTCAAACTATTCCAAAAACTAGG - Intergenic
933953604 2:87350462-87350484 CTCAAACTATTTTGAAAAACAGG - Intergenic
934111090 2:88743581-88743603 CTGAAACTATTCCAAAAGATGGG - Intronic
934237809 2:90246710-90246732 CTCAAACTATTTTGAAAAACAGG - Intergenic
934275392 2:91570021-91570043 CTCAAACTATTTTGAAAAACAGG + Intergenic
934321941 2:91979259-91979281 CTCAAACTATTTTGAAAAACAGG - Intergenic
934460226 2:94210042-94210064 CTCAAACTATTTTGAAAAACAGG - Intergenic
934996311 2:98964210-98964232 CTGAAACTATTCCAAAAATTGGG - Intergenic
935402460 2:102674592-102674614 CTCAAGTTATGTCAAATAACGGG - Intronic
935442367 2:103115761-103115783 CTCAGGATAATCTAAAAAACTGG + Intergenic
937330837 2:121027762-121027784 CACAAGCTCTTTCAGAAAACGGG - Intergenic
937545072 2:123006042-123006064 AGAAAGCTAATCCAAAAAACGGG + Intergenic
938163168 2:129004736-129004758 CTGAAGTTATTCCATGAAACAGG - Intergenic
938425657 2:131184678-131184700 CTGAAACTATTCCAAAAAGAGGG + Intronic
939783790 2:146482926-146482948 ATCAATATATTCAAAAAAACAGG + Intergenic
941135879 2:161717836-161717858 CTGAAACTATTCCAAACAATTGG - Intronic
941438996 2:165509918-165509940 CTCAAGCTCTTCAAAAAATCAGG - Intronic
942350403 2:175046591-175046613 TTCAAACTATTCCAGAAAATGGG - Intergenic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
944393277 2:199242132-199242154 CTGAAACTATTCCAATCAACAGG - Intergenic
944737444 2:202580435-202580457 CTGAAACTGTTCCAAAAAATCGG - Intergenic
944954484 2:204792542-204792564 CTCTAGCTATTAAAAAAAAATGG - Intronic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
945736014 2:213601296-213601318 CTCCATCTCTTCCAAAACACTGG - Intronic
945803254 2:214460886-214460908 CGAAAGCAAATCCAAAAAACTGG - Intronic
947104769 2:226657760-226657782 TTCAAGCAATTCAAATAAACTGG - Intergenic
947138404 2:226997935-226997957 CTAAAGTTATGCCAACAAACTGG + Exonic
947322213 2:228933010-228933032 CTGAAACTATTCCAAACAATAGG - Intronic
948391896 2:237617723-237617745 CCCAAGCTCTTCTAGAAAACGGG + Intergenic
1169980927 20:11383134-11383156 CTAAAACTATTCCAAACAATTGG + Intergenic
1171362219 20:24595541-24595563 CTGAAACTATTACAAAAAAGTGG - Intronic
1173064247 20:39694939-39694961 CTCAAATGATTCCAAGAAACTGG - Intergenic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1176591351 21:8653080-8653102 CTCAAACTATTTTGAAAAACAGG - Intergenic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1177621887 21:23606311-23606333 CTGAAACTATTCCAAAAAATTGG + Intergenic
1180274200 22:10630191-10630213 CTCAAACTATTTTGAAAAACAGG - Intergenic
1180393630 22:12308780-12308802 TTCAAGGCATTGCAAAAAACTGG + Intergenic
1180406119 22:12555972-12555994 TTCAAGGCATTGCAAAAAACTGG - Intergenic
1180548688 22:16525186-16525208 CTCAAACTATTTTGAAAAACAGG - Intergenic
1181356024 22:22296710-22296732 CTCAAACTATTTTGAAAAACAGG + Intergenic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
949163075 3:905514-905536 GTAAAGCAATTACAAAAAACAGG + Intergenic
950236135 3:11321884-11321906 TTCCAGCTATTCCATAAAAATGG + Intronic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
952105307 3:30063739-30063761 CTCAAGAGATTCCAGAAAAGTGG - Intergenic
953081726 3:39626000-39626022 CAAAAGCAAATCCAAAAAACTGG + Intergenic
954220430 3:49150298-49150320 GTCAAGCCAGTCCAAAATACAGG + Intergenic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
957166930 3:76686525-76686547 CTCAAACTATTTTTAAAAACTGG - Intronic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
958020706 3:87991735-87991757 CCCAAGCCATGCCAAAAAATTGG - Exonic
958789936 3:98640265-98640287 CTGAAGCTATTCCAAAAGATAGG - Intergenic
959306952 3:104679505-104679527 CTCAAACTATTCTGAAAAAGAGG + Intergenic
959341987 3:105143466-105143488 CTCAAGGTATTCAAAAAAAAAGG - Intergenic
960276899 3:115738919-115738941 CTAAAACTATTCCAAACAATTGG - Intergenic
962038397 3:131678971-131678993 CTGAAACTATTTCAAAAAATTGG - Intronic
962763234 3:138537616-138537638 CTCAAGAATTTCCATAAAACTGG + Intronic
963325389 3:143856771-143856793 CTCATGCTGAGCCAAAAAACAGG + Intergenic
964519528 3:157548718-157548740 CTAAAACTCTTCAAAAAAACTGG - Intronic
964803805 3:160584750-160584772 CTCAAACTCTTCAAAAAAAAAGG + Intergenic
965016520 3:163165515-163165537 CTCAATCTATTCTGAAAAATAGG - Intergenic
965471563 3:169099164-169099186 CTCCAGCTATACCAAAATGCTGG + Intronic
965478743 3:169190235-169190257 CTCAAGGTATTTTAAAAATCTGG + Intronic
965608964 3:170525190-170525212 CTCATGCTTTTGCAAAAAGCCGG + Intronic
966269323 3:178085566-178085588 TTCAAGCTATTTCAAGAAGCTGG + Intergenic
967003529 3:185360714-185360736 CTGAAGCAATTCAACAAAACAGG - Intronic
967203582 3:187098466-187098488 CTGAAACTATTCCAAAAGATAGG + Intergenic
968004555 3:195231934-195231956 CTCAAACTATTCTGAAAAATAGG - Intronic
968580416 4:1388973-1388995 CACAAACTCTTCCAAAAAATAGG - Intergenic
970325825 4:14924825-14924847 CTCATGCTTTACCAAACAACTGG + Intergenic
971466845 4:26972784-26972806 CTGAAACTATTCCAATCAACAGG - Intronic
971587930 4:28429329-28429351 CTCAAACTATTTTAAAAAATTGG - Intergenic
971616150 4:28792845-28792867 CTCAGACTATTTCATAAAACAGG + Intergenic
971813435 4:31457684-31457706 TTCATGCTTATCCAAAAAACGGG + Intergenic
972241124 4:37193544-37193566 ATCAAGCTATTATAACAAACGGG + Intergenic
972755898 4:42045669-42045691 CTGAAACTATTCCAAACAATAGG + Intronic
973698132 4:53511200-53511222 CTCAAGCTAAGCCAAGAGACTGG - Intronic
973731867 4:53830573-53830595 CTCAACTTATTGCCAAAAACAGG - Intronic
974342225 4:60628898-60628920 CTGAAACTATTCCAAACAATAGG - Intergenic
974473812 4:62354387-62354409 ATGAAGCTATTACAAAAAAAAGG + Intergenic
974522571 4:63003153-63003175 CAGAAGCTATTCCCAAGAACAGG - Intergenic
974966292 4:68764530-68764552 CTGAAGCTATTTCAAAAAATTGG + Intergenic
975055212 4:69922241-69922263 CTCAAGACATCCCCAAAAACTGG - Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
976016739 4:80564128-80564150 CTCAACCTATTATAAAAAATAGG + Intronic
976389543 4:84495136-84495158 CTTAAGCTAAGCTAAAAAACAGG + Intronic
977634820 4:99285216-99285238 ATCAAACTATAACAAAAAACAGG - Intronic
977874555 4:102132886-102132908 TTCAAGTTGTTCCAAGAAACAGG + Intergenic
977994780 4:103488348-103488370 CTGAAGCTATTCCAAATAATAGG + Intergenic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978361795 4:107938655-107938677 CTCAAGCTAGTTCATCAAACAGG - Intronic
978922126 4:114197036-114197058 CTCAAACTATTCTGAAAAATAGG - Intergenic
979291942 4:118988135-118988157 CTCTAGCTATTCAAATAAACAGG - Intronic
979658685 4:123226754-123226776 CTGAAACTATTCCAATCAACAGG - Intronic
979676846 4:123419143-123419165 CTGAAGCTATTTTAACAAACAGG - Intergenic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
980893522 4:138839339-138839361 ATCATTCTATTCCATAAAACCGG + Intergenic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981996392 4:150979919-150979941 CTCAAATTATTCCGAAAAATAGG + Intronic
983008398 4:162515095-162515117 CCCAAGTTATTCCAAGAAATAGG + Intergenic
983588957 4:169386392-169386414 CACAAGCTGTTCCAAAATAGAGG - Intergenic
984792382 4:183626541-183626563 CTTAAAATATTCAAAAAAACAGG - Intergenic
987537935 5:19212084-19212106 CTCAAACTATTCTGAAAAACAGG + Intergenic
987631790 5:20482380-20482402 CTCAAACTATTACAAAAAGTAGG + Intronic
989069116 5:37491651-37491673 ACCCAGCTATTCCAAAAAAATGG + Intronic
989789204 5:45374596-45374618 CTTAAACTATTCCAAAAACTTGG + Intronic
990313609 5:54563794-54563816 CTCAAGCTATTTCAAATAGAAGG - Intergenic
990351074 5:54917115-54917137 CCCAAGCTTTTCCCAAAAAATGG - Intergenic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
990894440 5:60682887-60682909 ATCAAATTATTCCAAAAAAATGG + Intronic
991682497 5:69152829-69152851 CTCAAGCTCTGCCAAAACAATGG - Intergenic
993205778 5:84876607-84876629 CTCAAACTGTTCCAAAAAATAGG + Intergenic
994015375 5:94958867-94958889 CTAAAACTATTCCAAACAATAGG + Intronic
994057549 5:95435380-95435402 CTCAAATTATTCCAAAAAGCAGG - Intronic
994707893 5:103228185-103228207 CTAAAACTATTCTGAAAAACTGG + Intergenic
995730889 5:115240447-115240469 CTTAAGCTAATCCAGAATACAGG - Intronic
995968981 5:117943900-117943922 CTCAAGCTATTACTAGGAACAGG - Intergenic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996541523 5:124634378-124634400 CTCAGGCTACTGCAAAAAGCAGG + Intergenic
996945683 5:129064370-129064392 CTCAATCTTTTCCACAAATCAGG - Intergenic
998528031 5:142860339-142860361 CTCAAGTGAATCCAGAAAACAGG - Intronic
998927102 5:147138511-147138533 CTGAAACTATTCCAAACAATAGG - Intergenic
999182102 5:149677020-149677042 CTAGAGCTATGGCAAAAAACAGG + Intergenic
999336060 5:150717907-150717929 CTTATGCTATGCCAAAAATCTGG + Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
1001606722 5:172965703-172965725 CACAAGCTCTTCCAAAATGCTGG + Intronic
1001840499 5:174872350-174872372 CTGAAGCTTATCCAAGAAACTGG - Intergenic
1002013162 5:176301039-176301061 CTCAGACTTTTGCAAAAAACCGG + Intronic
1003394017 6:5737573-5737595 CTCACACTATTCCAGAAAGCAGG - Intronic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1005416637 6:25606747-25606769 CTAAAACTATTCACAAAAACAGG - Intronic
1005907956 6:30281719-30281741 CTCAAGCTATTGAAAAATAGAGG - Intergenic
1006278991 6:33031459-33031481 CACAAGCGATTCCAAAAGACGGG - Intergenic
1008641708 6:53469869-53469891 CTGAAACTACTCCAAAAAATAGG - Intergenic
1010304106 6:74297710-74297732 TTCAAACTCTTCCAAAAAAGTGG + Intergenic
1010466200 6:76169230-76169252 CTATAACTATTCCAAAACACAGG + Intergenic
1011433261 6:87310704-87310726 CTCAATCAAAGCCAAAAAACAGG + Intronic
1011694192 6:89897419-89897441 CTCAAGTTATTCTAAAACAGTGG - Intergenic
1012875246 6:104718882-104718904 TTCAAGTTATTCCATAAAAGAGG - Intergenic
1013964530 6:115938924-115938946 CTGAAACTATTCCAAACAATAGG + Exonic
1014058127 6:117040311-117040333 CTGAAACTATTCCAAACAATAGG - Intergenic
1014419696 6:121227839-121227861 CACAAGCTTTTTCAGAAAACAGG - Intronic
1014658503 6:124136453-124136475 CTGAAACTATTCCAAAAGATGGG + Intronic
1014703563 6:124719217-124719239 CCCAACCTATTCCATAAAATTGG + Intronic
1014737575 6:125112468-125112490 CAAAAGCTACTTCAAAAAACTGG - Intergenic
1015900140 6:138056556-138056578 CTAAAACTATTCCAAAAGATAGG + Intergenic
1016252542 6:142062274-142062296 CTCAAGCTATTCTAATAGAAAGG - Intronic
1016457976 6:144250865-144250887 CTCAAACTATTCAATAACACTGG + Intergenic
1020210691 7:6155988-6156010 CTCAAGCGATCCCAAAGCACTGG + Intronic
1020546321 7:9536486-9536508 CTGAAACTATCCCAAAATACTGG - Intergenic
1021050504 7:15978127-15978149 CTCAATCAATTCCTAAAAGCTGG - Intergenic
1021305491 7:19026489-19026511 CTAAAACTACACCAAAAAACTGG + Intronic
1021465740 7:20941624-20941646 CTCAAACTTTTCCAAAAAAATGG + Intergenic
1022050387 7:26662899-26662921 CTCAGGCTATTCCAAGGAGCTGG - Intergenic
1023016572 7:35973983-35974005 TACAAGATATTCCAAAAAAAAGG + Intergenic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1025547525 7:62195962-62195984 CTGAAACTATTCCAATCAACAGG - Intergenic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1032247815 7:130228113-130228135 CTAAAGCTTTTCAAAACAACTGG + Intergenic
1032272887 7:130427621-130427643 CTTAAGGTATTCCAAAATAGAGG + Intronic
1032966682 7:137105776-137105798 CTGAAACTATTGCAAACAACAGG + Intergenic
1033525957 7:142213770-142213792 CTGAAACTATTCCAAACAAGAGG + Intronic
1033872277 7:145769556-145769578 TTCAAACTATTAAAAAAAACTGG - Intergenic
1035554845 8:559341-559363 CTGAAACTATTCCAAACAATTGG + Intergenic
1036425733 8:8643818-8643840 CACAAGATATTGCAAACAACAGG + Intergenic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1037428071 8:18778997-18779019 CTCAAACTATTCCGAAAAATTGG - Intronic
1037939012 8:22936553-22936575 CTCAAACTCTTCCAAAACATTGG + Intronic
1038780649 8:30566329-30566351 CTCTAGCTGTTCTACAAAACTGG + Intronic
1039222897 8:35355212-35355234 CTCAAGTTGTTCAAAAAAAAGGG - Intronic
1039289587 8:36079477-36079499 CTGAAACTACTCCAAAAAATTGG + Intergenic
1039678724 8:39704157-39704179 CTGAAACTATTCCATAAAATTGG + Intronic
1040684740 8:49858265-49858287 CTCAATTTCTTCCAAAAAATTGG - Intergenic
1040858656 8:51976618-51976640 CACAAGCTATTTAGAAAAACAGG + Intergenic
1041630241 8:60079436-60079458 CTGAAACTATTCCAAACAATAGG - Intergenic
1041823563 8:62066362-62066384 CTCAAACTATTCAGAAAAATAGG + Intergenic
1041922633 8:63199750-63199772 TTTAAGCCATTCCAAGAAACAGG - Intronic
1042038361 8:64563340-64563362 CTGAAACTATTCCAAACAATAGG - Intergenic
1042070480 8:64927985-64928007 CTGAAACTATTCCAAACAATTGG - Intergenic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1043978639 8:86612586-86612608 CTGAAGCTGTTACAGAAAACTGG - Intronic
1044007064 8:86950686-86950708 CTCAAACTATTCTGAAAAACAGG - Intronic
1044372840 8:91433696-91433718 CTCCAGCTATTGCAAATGACAGG + Intergenic
1044877016 8:96679466-96679488 CTCAAACTATTCAAAAAAATTGG - Intronic
1046020151 8:108655369-108655391 CTCAAGCTATTCTCCAAACCTGG - Intronic
1046113849 8:109761315-109761337 CTCAGACTATTCTGAAAAACAGG - Intergenic
1046763337 8:118043822-118043844 CCAAATCTATGCCAAAAAACAGG + Intronic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1047538198 8:125738527-125738549 TTCAAGCAATTCCAAGATACAGG + Intergenic
1048435274 8:134410653-134410675 CTCCAGCCATACCAAACAACTGG + Intergenic
1049452876 8:142671779-142671801 CTCAAGCGATCCCAAAATGCTGG + Intronic
1050109960 9:2204548-2204570 GTCAAAGTATACCAAAAAACAGG + Intergenic
1050141236 9:2518135-2518157 CTGAAACTATTCCAAACAATAGG - Intergenic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1050927288 9:11280394-11280416 CTCAGGGTACTCCAAAAAATAGG + Intergenic
1051793874 9:20841270-20841292 CTTAAACTATTACAAAAAATAGG - Intronic
1052094319 9:24366120-24366142 CTGAAACTATTTCAAAAAACTGG - Intergenic
1052363985 9:27590370-27590392 CTCTAGCAATTCAAAAAAGCTGG + Intergenic
1052458088 9:28727200-28727222 CCCAAACTATTCCAAAGAATAGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1055911423 9:81356782-81356804 CCCAAACTGTTCCAAAAAATAGG + Intergenic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1056931865 9:90885037-90885059 CAAAAGCAATTTCAAAAAACTGG + Intronic
1059062524 9:111048389-111048411 ATGAAGATATTCCAAAAATCTGG - Intergenic
1059999342 9:119944140-119944162 CTCAAGCTATTTCAAAGAAGAGG - Intergenic
1203621379 Un_KI270749v1:131844-131866 CTCAAACTATTTTGAAAAACAGG - Intergenic
1186749784 X:12609610-12609632 CTCACTCTCTACCAAAAAACAGG + Intronic
1188393379 X:29649195-29649217 CTCAAGCTATTACAAAAAATTGG + Intronic
1188426734 X:30056600-30056622 ATCAAACTATTTTAAAAAACAGG - Intergenic
1188725213 X:33574460-33574482 CTGAAACTATTACAAAAAATTGG - Intergenic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1192133894 X:68578816-68578838 CTGAAACTATTCCAATCAACAGG - Intergenic
1192806025 X:74510033-74510055 CACAAACTCTTCCAAAAAATTGG - Intronic
1192857919 X:75033776-75033798 CTGAAACTATTCCAAACAATAGG - Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193215774 X:78862466-78862488 CCCAAACTATTCCAAACAGCAGG + Intergenic
1193252112 X:79303365-79303387 CTAAAACCATTCCAAAAAAGTGG + Intergenic
1193513792 X:82437773-82437795 CTGAAACTATTTCAAAAGACAGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1194203862 X:90987095-90987117 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1194439083 X:93907157-93907179 CTCAAACTATTCTAAAAAATAGG - Intergenic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1195586432 X:106570385-106570407 CTGAAACTATTCCAAGAAATTGG + Intergenic
1195924273 X:110010017-110010039 CTGTGGCTATTTCAAAAAACAGG - Intronic
1195982997 X:110600419-110600441 CTCAAACTATTCTGAAAAATAGG - Intergenic
1196599656 X:117587195-117587217 CTCAAACTAACTCAAAAAACAGG - Intergenic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197402979 X:126015373-126015395 CTCAAACTATTACAAAAATAGGG - Intergenic
1200549699 Y:4562544-4562566 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1201189423 Y:11434438-11434460 CTCAAACTATTTTGAAAAACAGG - Intergenic
1201967165 Y:19750712-19750734 CTGAAGCTATTTTTAAAAACTGG - Intergenic
1202044159 Y:20720837-20720859 CTGAAACTATTCCAATCAACAGG + Intergenic
1202241566 Y:22775831-22775853 CTGAAGTTATTCCAATCAACAGG - Intergenic
1202394549 Y:24409574-24409596 CTGAAGTTATTCCAATCAACAGG - Intergenic
1202476235 Y:25260518-25260540 CTGAAGTTATTCCAATCAACAGG + Intergenic
1202584215 Y:26407539-26407561 CTCAAACTATTTTGAAAAACAGG + Intergenic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic