ID: 918025644

View in Genome Browser
Species Human (GRCh38)
Location 1:180742284-180742306
Sequence CTGCTAAAACAGTGCTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1426
Summary {0: 1, 1: 1, 2: 29, 3: 185, 4: 1210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918025644_918025646 -2 Left 918025644 1:180742284-180742306 CCCTGTAAGCACTGTTTTAGCAG 0: 1
1: 1
2: 29
3: 185
4: 1210
Right 918025646 1:180742305-180742327 AGTATCCCTCAAATTTTGATAGG 0: 1
1: 2
2: 3
3: 28
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918025644 Original CRISPR CTGCTAAAACAGTGCTTACA GGG (reversed) Intronic
900766189 1:4507315-4507337 CTGCTCAGACAGTGCTTTAAGGG + Intergenic
902266360 1:15269312-15269334 CAGTGAAAGCAGTGCTTACAGGG - Intronic
903090768 1:20914153-20914175 CTGCTAAAGCAGTACATAGATGG - Intronic
903638370 1:24836973-24836995 TGGCTAAAACTGTGCTTAGAGGG + Intronic
904582435 1:31555362-31555384 CAGCTAAAACAGAGCTTGTAGGG - Intergenic
904979777 1:34489188-34489210 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
905848372 1:41254301-41254323 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
905923651 1:41734911-41734933 GTGTTAAGAGAGTGCTTACAGGG + Intronic
906558148 1:46731326-46731348 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
906736641 1:48136016-48136038 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
906739682 1:48170469-48170491 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
906752317 1:48276485-48276507 CAGCTAAAACAGTGTTTACAGGG - Intergenic
906890385 1:49706698-49706720 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
907493115 1:54822561-54822583 CAGCAAAAGCAGTGCTAACAGGG - Intronic
907801874 1:57775416-57775438 CAGCTAAAACAGTGCTTAAAGGG - Intronic
908283502 1:62568240-62568262 CAGCTAAAGCAGTGTTAACAGGG + Intronic
908593151 1:65654958-65654980 CAGCTAAAACAGTGCTTAAAGGG + Intergenic
908701092 1:66901345-66901367 CAGCTAAAGCACTGCTTAGAGGG - Intronic
908723760 1:67153598-67153620 CAGCTAAACCAGTGTTTAGAGGG - Intronic
908933851 1:69350077-69350099 CAGCTAAAGCAGTGCTTAAAGGG + Intergenic
909415953 1:75405696-75405718 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
909805466 1:79869364-79869386 AAGCTAAAACAGTGTTTAGAGGG + Intergenic
909874623 1:80786509-80786531 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
910177495 1:84446059-84446081 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
910619075 1:89233396-89233418 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
910748331 1:90598838-90598860 CAGCTAAAGCAGTGTGTACAGGG + Intergenic
910754819 1:90677399-90677421 TAGTTAAAACAGTGCTTAAAGGG + Intergenic
910805444 1:91185821-91185843 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
910912815 1:92255752-92255774 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
911025314 1:93429581-93429603 ATGCTAAAGCAGTGCTTAGGAGG + Intergenic
911270938 1:95800219-95800241 CAGCTGAAGCAGTGTTTACAGGG + Intergenic
911359523 1:96859566-96859588 CAGCTAAAGCAGTGCTAAGATGG - Intergenic
911373888 1:97026729-97026751 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
911424028 1:97684185-97684207 CTGCTAAAGCAGTGTTAAGAGGG - Intronic
911541082 1:99159404-99159426 CATCTAAAGCAGTGCTTAGAGGG - Intergenic
911691755 1:100842771-100842793 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
911816285 1:102356638-102356660 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
912032287 1:105263924-105263946 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
912133079 1:106625926-106625948 CAGCTAAAACAGCGTTTAGAGGG - Intergenic
912284276 1:108351892-108351914 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
912660462 1:111524523-111524545 CAGCTAAAGCAGTGCTTAGAGGG - Intronic
912894581 1:113573346-113573368 CAGCTAAAGCAGTGTTTAGACGG - Intronic
912967018 1:114244781-114244803 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
912976224 1:114332741-114332763 CAGCTAAAGCAGGGCTTAGAGGG - Intergenic
913035965 1:114966496-114966518 CAGCTAAAGCAGTGTTTATAGGG - Intronic
913078792 1:115362918-115362940 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
913398914 1:118406117-118406139 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
913430014 1:118780575-118780597 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
916182903 1:162103085-162103107 CAGCTAAAACAGTGTTAAGAGGG - Intronic
916314265 1:163430275-163430297 CACTTAAAATAGTGCTTACAAGG - Intergenic
916359693 1:163953764-163953786 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
916363075 1:163992583-163992605 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
916561425 1:165936850-165936872 CTGCTAAAGCACTGATTGCAAGG - Intergenic
916612535 1:166407085-166407107 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
916625329 1:166549593-166549615 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
916874699 1:168956827-168956849 CAGCTAAAACAGTGTTTAGAAGG - Intergenic
916898011 1:169186902-169186924 CAGCTAAAACAGTGTTTAGAGGG - Intronic
917019661 1:170572198-170572220 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
917162826 1:172077464-172077486 CAGTTAAAGCAGTGTTTACAGGG - Intronic
917358014 1:174146242-174146264 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
917370873 1:174292403-174292425 CAGCTAAAGCAGTGGTTAGAGGG - Intronic
917568735 1:176239960-176239982 CTGCAAAAACAGTGCTTAGAAGG - Intergenic
917800824 1:178568553-178568575 CAACAAAAACAGTGTTTACAGGG - Intergenic
917915522 1:179697313-179697335 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
917983909 1:180295239-180295261 CAGCTAAACCAGTGCTTTAAAGG - Intronic
917997133 1:180452092-180452114 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
918025644 1:180742284-180742306 CTGCTAAAACAGTGCTTACAGGG - Intronic
918156511 1:181852080-181852102 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
918169048 1:181977913-181977935 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
918174640 1:182032271-182032293 CTATTAAAACAGTGTTTTCAAGG - Intergenic
918501166 1:185198089-185198111 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
918612542 1:186509541-186509563 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
918631711 1:186727005-186727027 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
919136284 1:193511861-193511883 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
919223448 1:194661874-194661896 CAGCTAAAACAGTGTTTGGAGGG + Intergenic
919284004 1:195529432-195529454 CAGCAAAAACAGTACTAACAGGG + Intergenic
920631551 1:207658119-207658141 CAGCTAAAGCATTGCTTACAGGG + Intronic
920642035 1:207762258-207762280 CAGCTAAAGCATTGCTTACAGGG + Intronic
920781794 1:208999587-208999609 TGACTAAAACAGTGATTACATGG + Intergenic
920985865 1:210888398-210888420 CAGCTAAAGCAGTGTTTACAGGG + Intronic
921228776 1:213047646-213047668 CAGCTAATGCAGTGCTTAGAGGG - Intergenic
921484582 1:215700959-215700981 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
921578770 1:216871135-216871157 CAGCTAAAGCAGTGCTTACAGGG - Intronic
921626477 1:217382680-217382702 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
921631546 1:217439357-217439379 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
921675532 1:217971716-217971738 CAGCTAAAACAGTATTAACATGG - Intergenic
921881311 1:220257565-220257587 CAGCTAAAACAGTGTTAAGAGGG + Intronic
921927702 1:220726078-220726100 AAGCTAAAACAGTGCTTAGCAGG - Intergenic
922379747 1:225011250-225011272 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
922381666 1:225035546-225035568 CTGCAAAAGCAGTACTAACAGGG - Intronic
922397691 1:225219156-225219178 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
922716285 1:227874813-227874835 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
922732460 1:227957982-227958004 CAGCTAAAGCAGTGCTGAGAGGG - Intergenic
922808979 1:228405714-228405736 CTGCTAACACAGTCCCTGCAGGG + Intronic
923422005 1:233825226-233825248 CAGCTAAAGCAGTGTTTATAGGG + Intergenic
924179691 1:241428109-241428131 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
924515865 1:244765599-244765621 CAGCAAAAACAGTACTAACAGGG - Intergenic
924629896 1:245727009-245727031 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
924828738 1:247570358-247570380 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
924893766 1:248314057-248314079 CAGCTAAAGCAGTGCTAAAAGGG - Intergenic
924926616 1:248690067-248690089 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1063394345 10:5672648-5672670 CAGCTAAAGCAGTGATTAGAGGG - Intergenic
1063431540 10:5994514-5994536 CAGCTAAAGCGGTGCTTAGAGGG + Intergenic
1063782839 10:9345911-9345933 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1063807553 10:9663725-9663747 CAGCAAAAACAGTGATTAGAGGG - Intergenic
1063912277 10:10843438-10843460 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1064789209 10:18936677-18936699 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1065621893 10:27590294-27590316 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1065735695 10:28750075-28750097 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1065907924 10:30275124-30275146 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1066150702 10:32613564-32613586 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1066694709 10:38067415-38067437 CTGCTTAAACAATGCTTGAAGGG + Intergenic
1066706885 10:38189816-38189838 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1066997801 10:42579764-42579786 CTGCTTAAACAATGCTTGAAGGG - Intronic
1067135658 10:43605474-43605496 CTGCGCAAACAGTGCTGAGAGGG + Intergenic
1067265597 10:44740741-44740763 CAGCAAAAGCAGTGCTTAGATGG + Intergenic
1067673666 10:48349610-48349632 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
1067906757 10:50299281-50299303 CAGCAAAAGCAGTGCTAACAGGG + Intergenic
1068186300 10:53590854-53590876 CAGCTAAAACAGTGCTAAGAGGG - Intergenic
1068372995 10:56143368-56143390 CAGCAAAAGCAGTGCTTAAAAGG - Intergenic
1068410035 10:56642934-56642956 CAACTAAAACAGTGTTTAGAGGG + Intergenic
1068490613 10:57719063-57719085 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1068761322 10:60713449-60713471 CAGCAAAACCAGTGCTTAGAGGG + Intronic
1069264013 10:66435830-66435852 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1070221924 10:74456820-74456842 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
1070584277 10:77749782-77749804 CAGCCAAAACAGTGCTGATAGGG + Intergenic
1071031615 10:81191453-81191475 CAGCTAAAACAGCGCTTAAAAGG + Intergenic
1071058011 10:81533239-81533261 CTTTGAAAACAGTGCTGACAAGG + Intergenic
1071224388 10:83510933-83510955 CAGCTAAAACAGTGCTGAGAGGG + Intergenic
1071401496 10:85277551-85277573 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1071472941 10:85998476-85998498 CAGGTAAACCAGTGCTTAGAGGG + Intronic
1071975575 10:90952452-90952474 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1071998528 10:91171141-91171163 GTGATATAACAGTGCATACATGG + Intronic
1072025734 10:91454508-91454530 CTGCTACAGCAGTGCTGAGAGGG + Intronic
1072218648 10:93309151-93309173 CTGCTAAGACAGTTCCTCCAAGG - Intronic
1072375429 10:94811034-94811056 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1072389310 10:94966840-94966862 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1073813338 10:107176072-107176094 CAGCTAAAGCAGTGATTATAGGG - Intergenic
1073939351 10:108677190-108677212 CAACTAAAGCAGTGCTTACAGGG - Intergenic
1073962647 10:108951528-108951550 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1074173717 10:110974155-110974177 CTGCTAAAAAAGTACTTTGAGGG - Intronic
1074194273 10:111167312-111167334 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1074218827 10:111415674-111415696 CTGCTAAGACAGTCCTTATGGGG + Intergenic
1074439786 10:113466927-113466949 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1074795211 10:116936320-116936342 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1075175090 10:120152745-120152767 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1075486374 10:122824777-122824799 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1075983627 10:126764172-126764194 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1076099222 10:127761326-127761348 CAGCTAAAGCAGTGCTTAGAAGG - Intergenic
1076390084 10:130093404-130093426 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1076613491 10:131741653-131741675 CAGCTAAAACAGAGCTTTGAGGG - Intergenic
1077561766 11:3267568-3267590 CAGCTAAAGCAGTTCTTAGAGGG - Intergenic
1077567660 11:3313388-3313410 CAGCTAAAGCAGTTCTTAGAGGG - Intergenic
1078167570 11:8901611-8901633 CAGCTAAAACTGTGATTAGAGGG - Intronic
1078819659 11:14864828-14864850 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1079278560 11:19065924-19065946 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1079300125 11:19270838-19270860 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1079316823 11:19414935-19414957 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1079510282 11:21202776-21202798 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1079518084 11:21291331-21291353 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1079799561 11:24852257-24852279 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1079934976 11:26606088-26606110 CAGCTAAAGCAGTATTTACAGGG - Intronic
1079993465 11:27271055-27271077 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1080016739 11:27515322-27515344 CAGCTACAGCAGTGCTTAGAGGG + Intergenic
1080164612 11:29222104-29222126 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1080710326 11:34740767-34740789 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
1081125300 11:39313838-39313860 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1081171628 11:39876580-39876602 TAGCTAAAGCAGTGTTTACAGGG + Intergenic
1081335422 11:41859800-41859822 CTGCTCAAATAGTCCTTCCAAGG + Intergenic
1081363571 11:42208360-42208382 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1081593214 11:44440287-44440309 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1081941723 11:46948510-46948532 CTGCGTAAGAAGTGCTTACATGG + Intronic
1082560507 11:54614959-54614981 CAGCAAAAACAGTGCTAAGAGGG - Intergenic
1082589387 11:54987231-54987253 CTACGAAAACAGTGTTTCCAAGG - Intergenic
1082903330 11:58280475-58280497 CAGCTAAAGCAATGGTTACAGGG - Intergenic
1083342469 11:61967577-61967599 CTGCTTCAACAGTGCTTGGACGG - Exonic
1084766877 11:71316560-71316582 GTGCTAAAGCAGTGCTTAATGGG - Intergenic
1085588607 11:77735178-77735200 CTGCTTCAACAGTGCTTGGACGG - Intronic
1085665300 11:78410121-78410143 CAGCTAAAGCAGTGCTGAGAGGG + Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1085884705 11:80508093-80508115 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1086182240 11:83966906-83966928 AGGATAAAACAGTGGTTACAGGG - Intronic
1086255983 11:84876834-84876856 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1086328524 11:85729580-85729602 CAGCTAAACCAGTGTTTAGAGGG + Intronic
1086349154 11:85927592-85927614 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1086608716 11:88727871-88727893 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1086723802 11:90156527-90156549 CAGCTAAAGTAGTGCTTATAGGG - Intronic
1086839732 11:91670031-91670053 CAGCTAAAACAGTGTTAAAAGGG + Intergenic
1086906859 11:92428534-92428556 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1087358596 11:97127778-97127800 CAGTGAAAACAGTGCCTACAGGG - Intergenic
1087446920 11:98267676-98267698 CACCTAAAGCAGTGCTTAGAGGG - Intergenic
1087695023 11:101366949-101366971 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1088197977 11:107296681-107296703 CAGCTAAAGCAGTGCTTTGAGGG + Intergenic
1088211655 11:107463663-107463685 CAGCTAAAGCAGTGCTTTGAGGG - Intergenic
1088294178 11:108274520-108274542 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1088307446 11:108424995-108425017 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1088661408 11:112050848-112050870 ATGCTAAAGCAGTGCTTAGCAGG + Intronic
1089420393 11:118328662-118328684 CTGCTAAAGCAGTATTTAGAAGG + Intergenic
1089686379 11:120150360-120150382 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1089888164 11:121850419-121850441 CAGCTAAAACAGTTCTGAAAAGG - Intergenic
1089945310 11:122464891-122464913 CAGCAAAAGCAGTGCTAACAAGG + Intergenic
1090282862 11:125472103-125472125 CAGCTAAAACAGTGCTTAAAGGG + Intronic
1090312982 11:125758935-125758957 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1090529183 11:127572762-127572784 CTGCTAAAGCAGTGTTTATAGGG + Intergenic
1090814554 11:130281125-130281147 CAGCTAAAGTAGTGCTTATAGGG + Intronic
1091089736 11:132759949-132759971 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1091200221 11:133773410-133773432 CAGCTAAATCAGTGCTTAGGTGG + Intergenic
1091213240 11:133882418-133882440 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1091365267 11:135014454-135014476 CTCCTAAAGCAGTGTTTACAGGG + Intergenic
1091852700 12:3713137-3713159 CAGCTACAATAGTGCTAACAAGG + Intronic
1091911773 12:4237521-4237543 CAGCTAAAGCAGTGCTAAGAGGG - Intergenic
1091926182 12:4351935-4351957 CTCATAAAACAGTGCTAACCAGG - Intronic
1092023914 12:5224926-5224948 ATGAAAGAACAGTGCTTACAGGG - Intergenic
1092316631 12:7423319-7423341 CAGCTAACACAGTGCTAAGAGGG + Intronic
1092493509 12:8968936-8968958 CAGCTAAAGCAGTGCTTACAGGG + Intronic
1092639191 12:10484660-10484682 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1092691170 12:11111642-11111664 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1092867168 12:12773133-12773155 CAGTAAAAGCAGTGCTTACAGGG + Intronic
1093099488 12:15010681-15010703 CTGCTGAATCACAGCTTACAGGG - Intergenic
1093273845 12:17099485-17099507 CAGGTAAAACAGTGTTTAGAGGG + Intergenic
1093335762 12:17903218-17903240 CAGCTAAAGCAGTGGTTAGAGGG - Intergenic
1093377837 12:18452717-18452739 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1093383061 12:18518884-18518906 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1093402564 12:18763842-18763864 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1093413374 12:18893378-18893400 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1093506834 12:19876924-19876946 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1093522782 12:20069765-20069787 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1093655611 12:21690782-21690804 CAGCTAAAACAGTGCAAAAAGGG + Intronic
1093664175 12:21792702-21792724 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1094170100 12:27482156-27482178 CAGTGGAAACAGTGCTTACAGGG - Intronic
1094449453 12:30568977-30568999 TGCCTAAATCAGTGCTTACATGG - Intergenic
1094656735 12:32427216-32427238 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1094730248 12:33166266-33166288 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1094732724 12:33197024-33197046 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1094769867 12:33643084-33643106 TTGCCAAAACAGAGCTTAGAAGG - Intergenic
1095118362 12:38383750-38383772 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1095230078 12:39729310-39729332 CAGCTAAAGCAGTGGTTACAGGG - Intronic
1095406576 12:41873125-41873147 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1095674518 12:44900602-44900624 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1095857674 12:46878686-46878708 CAGCTAAAGCAGTGCTAAAAGGG + Intergenic
1095931215 12:47627132-47627154 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1096027760 12:48382261-48382283 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1096733575 12:53634437-53634459 CAGCTAAACCAGTGCTTAGAGGG - Intronic
1096742773 12:53706238-53706260 CTGCTAATCCAGTGCTTTCCAGG + Intergenic
1097075894 12:56393833-56393855 TTGCTAAAGCTGTGCTTAGAAGG + Intergenic
1097455500 12:59794347-59794369 TAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1097498743 12:60376282-60376304 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1097654116 12:62340539-62340561 CTGCTAAAGCAGTGTGTAGAGGG - Intronic
1097763078 12:63491300-63491322 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1098764263 12:74466666-74466688 CGGCTAAAACAGTGTTAAGAGGG - Intergenic
1098868761 12:75792185-75792207 TAGCTAAAGCAGTGCTTAGAAGG + Intergenic
1098888989 12:75989239-75989261 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1099183768 12:79496491-79496513 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1099235830 12:80081438-80081460 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1099238664 12:80113403-80113425 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1099344269 12:81478568-81478590 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1099672488 12:85712224-85712246 CTGCCCAAACAGCACTTACATGG - Intergenic
1099797527 12:87418306-87418328 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1099822800 12:87734815-87734837 CTGCTAAAGCAGTGTTTAGAGGG - Intergenic
1099880732 12:88464289-88464311 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1099953611 12:89331058-89331080 CAGCTAAAGCAGTGATTAAAGGG + Intergenic
1100422377 12:94448771-94448793 CAACTAAAGCAGTGCTTAGAAGG + Intronic
1100566725 12:95801869-95801891 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1100683284 12:96954754-96954776 CAGCTAGAGCAGTACTTACAGGG + Intergenic
1100768452 12:97895447-97895469 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1100798286 12:98204968-98204990 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1100903071 12:99265461-99265483 CTGCTAAAACAGAGATTGCTGGG - Intronic
1101127859 12:101657199-101657221 CAGCAAAAGCAGTGCTTAAAGGG + Intronic
1101184033 12:102254291-102254313 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1101296422 12:103427964-103427986 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1101313334 12:103604992-103605014 CACTTAAAGCAGTGCTTACAAGG - Intronic
1101472377 12:105010627-105010649 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1101783670 12:107862815-107862837 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1101792785 12:107944218-107944240 CAGCAAAAACAGTACTTAGAGGG + Intergenic
1103169496 12:118803282-118803304 CTGCTAAAGCAGTGCTTGGAAGG - Intergenic
1105101043 13:16453511-16453533 CTACAAAAAGAGTGCTTAAAAGG - Intergenic
1105427804 13:20310092-20310114 CAGCTAAAACAATGCTTAGAGGG + Intergenic
1105430054 13:20328277-20328299 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1105485111 13:20821356-20821378 CAGCAAAAACATTGTTTACAGGG - Intronic
1105672411 13:22634205-22634227 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1105678104 13:22696729-22696751 CTGCTTCAACAGTGCTTGGACGG - Intergenic
1105748975 13:23403896-23403918 CTGCTAAAGCAGTGTTTAGAGGG - Intronic
1106298933 13:28444865-28444887 AAGCTAAAACAGTGTTTAGAGGG + Intronic
1106336227 13:28785714-28785736 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1106367378 13:29094830-29094852 CAGCTAAAGCAATGCTTAAAAGG - Intronic
1106375823 13:29187102-29187124 CAGCTAAAGCAGTGCTTACAGGG + Intronic
1106390694 13:29333021-29333043 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1106426300 13:29633777-29633799 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
1106723407 13:32459129-32459151 CAGCAAAAACAGTGCTAAGAGGG + Intronic
1106891725 13:34253423-34253445 CTGGTTAAACAGTTATTACAGGG + Intergenic
1106983574 13:35319249-35319271 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1107207653 13:37813245-37813267 ATGTAAAAGCAGTGCTTACAAGG + Intronic
1107970569 13:45638324-45638346 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1108135764 13:47356800-47356822 CTTCAAAAACAGTTCTAACAGGG - Intergenic
1108150983 13:47533935-47533957 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1108417686 13:50216260-50216282 CAACAAAAACAGTGCTTAAAGGG + Intronic
1108545100 13:51485395-51485417 CAGCTAAAGCAGTGGTTAGAGGG - Intergenic
1108673745 13:52718493-52718515 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1108858362 13:54823356-54823378 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1108925146 13:55733288-55733310 CAGCTAGAACAGTGTTTAGAGGG + Intergenic
1109161837 13:58984981-58985003 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1109188195 13:59294677-59294699 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1109196199 13:59380096-59380118 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
1109203801 13:59459681-59459703 CTGGTAAAACAGTGTCTGCAAGG + Intergenic
1109307658 13:60658943-60658965 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1109328919 13:60903311-60903333 AAGCTAAAACAGTGTTTAGAGGG + Intergenic
1109457173 13:62608632-62608654 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1109541057 13:63779581-63779603 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1109569046 13:64162188-64162210 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1109626364 13:64980134-64980156 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1109635255 13:65107055-65107077 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1109640325 13:65183075-65183097 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1109695815 13:65955961-65955983 CTGCCAAAACAATGCTAATAGGG - Intergenic
1109731380 13:66418580-66418602 CAGCTAAATCAGTGTTTAGAGGG + Intronic
1109769251 13:66948986-66949008 ATGCTAAATCAGTGCTTAAAAGG + Intronic
1109902521 13:68793004-68793026 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1110067846 13:71131323-71131345 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1110360438 13:74618861-74618883 CAGCAAAAACAGTACTTAGAGGG + Intergenic
1110663186 13:78083056-78083078 CAGCAAAAACAGTTCTTAGAGGG - Intergenic
1110732762 13:78898681-78898703 CAGCAAAAGCAGAGCTTACAGGG + Intergenic
1110737184 13:78950971-78950993 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1111305924 13:86412348-86412370 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1111352071 13:87044310-87044332 CAGCAAAAACAGTGTTTAGAGGG + Intergenic
1111391656 13:87604304-87604326 CAGCTAAAACAGTGTTAAAAGGG - Intergenic
1111862110 13:93720717-93720739 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1111953867 13:94734628-94734650 CAGTTAAAACAGTGCTTAGAGGG - Intergenic
1112166136 13:96921721-96921743 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1112251961 13:97789978-97790000 CTGTTAAAACAGTACTTACAGGG - Intergenic
1112898629 13:104333027-104333049 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1113131379 13:107041206-107041228 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1113137643 13:107111640-107111662 CTGCTTAAGCATTTCTTACAGGG + Intergenic
1113264546 13:108602968-108602990 CTGCTTAACCAGGGCTTAAATGG - Intronic
1113417776 13:110143011-110143033 CAGGTAAATCAGTGCTTAGAGGG + Intergenic
1113527992 13:110996538-110996560 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1113683911 13:112265505-112265527 CAGCTAAAACAGAGCTTAGAAGG - Intergenic
1113865916 13:113523769-113523791 CGGCTAAAACAGTGCTGAGAGGG - Intronic
1114337422 14:21705875-21705897 CAGCTAAAGCAGTGCTTAAAGGG - Intergenic
1114353978 14:21887128-21887150 ATGTCAAAACAGTACTTACATGG - Intergenic
1114360818 14:21970281-21970303 CAGCTAAAACAGTGGTGAGAGGG + Intergenic
1114956050 14:27820783-27820805 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1115018200 14:28642104-28642126 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1115043266 14:28957114-28957136 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1115048412 14:29026525-29026547 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
1115089887 14:29561513-29561535 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1115311039 14:31978418-31978440 CAGCTAAAACAGTGCATAGAAGG - Intergenic
1115690680 14:35841002-35841024 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1115720819 14:36159398-36159420 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1115756339 14:36529313-36529335 CAGCTAAAGTAGTGCTTAGAGGG - Intergenic
1115855974 14:37630231-37630253 CAGCTAAAGCAGTGTTTACAGGG - Intronic
1115911874 14:38266092-38266114 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1116009143 14:39330615-39330637 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1116247316 14:42432528-42432550 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1116291164 14:43042850-43042872 CTGCTAAGACAGTGCTTAGGAGG - Intergenic
1116511543 14:45753189-45753211 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1116565695 14:46441472-46441494 CAGCAAAAGCAGTGTTTACAGGG + Intergenic
1116572206 14:46532558-46532580 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1116771166 14:49128909-49128931 TAGCTAAAGCAGTGTTTACAGGG - Intergenic
1116775937 14:49180671-49180693 CAGCTAAAGCAATGCTTAGAGGG + Intergenic
1116792240 14:49351708-49351730 CAGCTAAAGCAGTGTTTAAAAGG - Intergenic
1116795581 14:49386469-49386491 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1117234355 14:53755879-53755901 CAGCTAAGACAGTGTTTAGAAGG + Intergenic
1117260431 14:54027578-54027600 CAGCTAAAGCAGTGCATAGAAGG - Intergenic
1117310269 14:54514750-54514772 CTGATAAAGCAGTACTTACAAGG - Intronic
1117466219 14:55997202-55997224 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1117640101 14:57789001-57789023 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1117716098 14:58583066-58583088 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1117915186 14:60670889-60670911 TAGCTTAAACAGTGCTTAGAAGG - Intergenic
1117927393 14:60797156-60797178 CTGCTAAAACACTGGTTACCTGG - Intronic
1118133759 14:62998604-62998626 CAGCAAAAGCAGTGCTTAGAGGG - Intronic
1118495686 14:66306183-66306205 CTGCTCAACCAGGGCTTACTGGG - Intergenic
1118521445 14:66590164-66590186 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1118915871 14:70104790-70104812 CAGCTAAGGCAGTGCTTAAAGGG + Intronic
1118962233 14:70544466-70544488 CAGCTAAAGCAGTGCTTACATGG + Intergenic
1119462196 14:74815799-74815821 CAGCTAAAGCAGTGCTTAAAAGG - Intronic
1120118679 14:80651568-80651590 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1120137553 14:80887618-80887640 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1120466246 14:84861333-84861355 CAGTTAAGACAGTGCTTAGATGG + Intergenic
1120773660 14:88409741-88409763 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1121470447 14:94149804-94149826 CAGCTAAAGCAGTGTTTAGAAGG - Intronic
1121606347 14:95243049-95243071 CTGCCAAAACACTGCATAAATGG + Intronic
1121899257 14:97677579-97677601 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1122146803 14:99694940-99694962 GTCCTAAAGCAGTGCTTAGAAGG - Intronic
1122193153 14:100064077-100064099 CAACTAAAACAGTGCTTAAAGGG + Intronic
1122776991 14:104122400-104122422 GAGCTAAAGCAGTGCTTAGACGG - Intergenic
1122832765 14:104409309-104409331 CAGTTAAAGCAGTGCTTAGAGGG + Intergenic
1123221318 14:106859050-106859072 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1123481110 15:20632066-20632088 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1123636901 15:22368299-22368321 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1123760188 15:23425769-23425791 CTGCTAATTCAGTGTTTGCAGGG - Intergenic
1123884197 15:24708100-24708122 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1123929169 15:25151383-25151405 CAGCTAAAGTAGTGCTTGCAAGG + Intergenic
1124009704 15:25828630-25828652 CAGCTAAAGCAGGGCTTAGAGGG + Intronic
1124084487 15:26534340-26534362 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1124205639 15:27717596-27717618 CAGCTAAAGCAGTGCTGAGAGGG - Intergenic
1124238463 15:28009954-28009976 CAGCTACAGCAGTGCTGACAGGG + Intronic
1124598056 15:31107702-31107724 CAGCTAAAATAGTGCTCAGAGGG - Intronic
1124790974 15:32726485-32726507 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1125054270 15:35339216-35339238 CAGCTAAAACAGTGTTAAGAGGG - Intronic
1125288794 15:38122712-38122734 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1125494407 15:40178215-40178237 CAACTAAAGCAGTGCTTAGAAGG - Intronic
1126284290 15:46993928-46993950 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1126470427 15:49004583-49004605 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1126614770 15:50566351-50566373 GAGCTAAAACAATGCTTAGAGGG + Intronic
1126995011 15:54432589-54432611 CAGCTAAAACAGTGTTAAGAGGG + Intronic
1127056628 15:55138505-55138527 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1127374011 15:58365884-58365906 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
1127677391 15:61254439-61254461 CAGTGAAAACAGTGCTTAGAGGG - Intergenic
1127938562 15:63669250-63669272 CAGCTAAAGCAGTACTTAAAGGG + Intronic
1128852227 15:70971135-70971157 GTGCTAAAGCAGTGTTTAGAGGG - Intronic
1128883974 15:71268446-71268468 CAGCTAAAGCAGTGTTGACAGGG + Intronic
1128973169 15:72127111-72127133 GACCTAAAACAGTGCTTACCAGG - Intronic
1129223045 15:74144869-74144891 CTGTTAAAACAGTACTTAGGAGG - Intergenic
1129489771 15:75912916-75912938 CAGCTAAAGCAGTGTTTACAGGG - Intronic
1129498862 15:76016488-76016510 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1130035120 15:80352413-80352435 CATCTAAAAAAGTGCTTAAAGGG + Intronic
1130310383 15:82748426-82748448 CAGTTAAAACAGTGATTAGAGGG + Intergenic
1131892656 15:96989652-96989674 CAGTGAAAACAGTGCTTAAAGGG - Intergenic
1131942419 15:97582264-97582286 CTGCTAAAGCAGTGTTAAGAGGG - Intergenic
1133316918 16:4890651-4890673 CGGCTAAAGCATTGCTTAGAGGG + Intronic
1134035639 16:11028831-11028853 CAGGTAAAGCAGTGCTTACAGGG - Intronic
1134363648 16:13556207-13556229 CTGCTAAATCAGTGGTGACTCGG + Intergenic
1134680965 16:16125194-16125216 CAGCTAAAGCAGTTCTTAGAGGG - Intronic
1135807851 16:25559141-25559163 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1135834261 16:25810116-25810138 CTGCTAAAGTAGTACTGACAGGG - Intronic
1135880960 16:26256377-26256399 CAGCTAAAGCAGTGCTGATAGGG + Intergenic
1137239575 16:46643826-46643848 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1137296652 16:47100298-47100320 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1137794943 16:51208602-51208624 CAGGTAAAACAGTGCTTAGAGGG - Intergenic
1137828388 16:51519766-51519788 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1138087441 16:54145600-54145622 CTTCTAATACAGTCCTCACAGGG - Intergenic
1138366006 16:56477951-56477973 CTGCTAAAACATTTCTTAACTGG - Exonic
1138706138 16:58917531-58917553 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1138843370 16:60536442-60536464 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1139023783 16:62787580-62787602 CAGCTAAAGCAGTGCTCAGAGGG - Intergenic
1139155216 16:64433317-64433339 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1140058982 16:71551002-71551024 GAGCTAAAATAGTGCTTAAAGGG + Intronic
1140233779 16:73140441-73140463 CTGCTGAGACAGTGCTCTCAGGG + Intronic
1140340712 16:74157272-74157294 CAGCCTAACCAGTGCTTACAGGG + Intergenic
1140669394 16:77261016-77261038 TTGCTAAACCAATGCTTAAAAGG - Intronic
1141245836 16:82306561-82306583 CAGCTAAAGCAGTGTTTAGATGG - Intergenic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1141442109 16:84036289-84036311 CAGCTAAAGCAGTGCTTAGAGGG + Intronic
1143255181 17:5552144-5552166 CAGCTAATGCAGTGCTTAAAGGG - Intronic
1143308544 17:5969066-5969088 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1143676681 17:8438309-8438331 CTGCTAAAACAATGCTCTAATGG - Intronic
1144372049 17:14600765-14600787 CAGGTAAAGCAGTGTTTACAGGG + Intergenic
1145228858 17:21155952-21155974 CAGCAAAAGCAGTGCTTAGAGGG + Intronic
1146410788 17:32582313-32582335 CTGCTGAAGCAATACTTACATGG - Intronic
1146741636 17:35289196-35289218 CAGCTAAAGCAATGCTTATAGGG + Intergenic
1146746032 17:35331073-35331095 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
1146934797 17:36806553-36806575 CAGTTAAAGCAGTGCTTACAGGG - Intergenic
1147525710 17:41220426-41220448 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1148402908 17:47383431-47383453 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1148963973 17:51418889-51418911 CTGCCATCACAGTGCTTACTCGG - Intergenic
1148967678 17:51449984-51450006 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1148981324 17:51577685-51577707 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1149352183 17:55801704-55801726 CAGCTAAAGCAGTGTTTAAAGGG + Intronic
1149653695 17:58297151-58297173 CAGCTAAAACAATGCATAGAGGG + Intergenic
1149966893 17:61173510-61173532 ACGCTAAAACAGTACTTAGAGGG + Intronic
1150028544 17:61705699-61705721 CAGCTAAAGCAGTGCTCAGATGG - Intronic
1150306858 17:64092945-64092967 CTACAAAATCAGTGCTTAGAAGG + Intronic
1152683388 17:81681752-81681774 CTGCTAAGCCAGTGCCTTCACGG + Exonic
1153058385 18:970655-970677 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1153119360 18:1702631-1702653 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1153258986 18:3203136-3203158 CAGCTAAAGCAGTACTTAGAGGG + Intronic
1153702926 18:7714357-7714379 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1154088560 18:11333725-11333747 TAGCTAAAGCAGTGCTTAGAAGG - Intergenic
1154293097 18:13127575-13127597 CTCCTAAGACAGTGTTTACTGGG - Intergenic
1154401824 18:14046029-14046051 CAACTAAAGCAGTGCTTAGAGGG - Intergenic
1155125159 18:22867624-22867646 CTGTCAAAGCAGTGCTTAGAGGG - Intronic
1155395524 18:25382464-25382486 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1155432323 18:25772519-25772541 CAGCTAACACAGTGCTCAGAGGG - Intergenic
1155723710 18:29052045-29052067 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1155857046 18:30847412-30847434 CAGCTAAAGCAGTGTTTACGGGG - Intergenic
1156151372 18:34247547-34247569 CTGTAAAAACAGTCCTTAGAGGG - Intergenic
1156230459 18:35149337-35149359 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1156414793 18:36876827-36876849 CAGCTAAAGCGGTGCTTAGAAGG - Intronic
1156435632 18:37125349-37125371 CAGCTAAAACAGTGTTTAGAGGG + Intronic
1157068373 18:44377818-44377840 CATTTAAAACAGTGCTTAGAGGG + Intergenic
1157072037 18:44419203-44419225 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1157178566 18:45475029-45475051 CAGCTAAAGCAGTGTTTAAAGGG - Intronic
1157470316 18:47983348-47983370 CTGGGAAAAGAGTGCTTAAAAGG - Intergenic
1157479298 18:48042877-48042899 CTGCTCTAACAGAGCTTAGAGGG + Intronic
1157821171 18:50770886-50770908 CAGCAAAAACAGTGCTAAGAGGG + Intergenic
1158264287 18:55643149-55643171 CAGCTAAAGCAGTGCTGATATGG + Intronic
1158398747 18:57101592-57101614 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1158433108 18:57409639-57409661 CAGATAAAGCAGTGCTTACAGGG + Intergenic
1158853706 18:61520913-61520935 CCGCTAAAGCAGTGTTTACAGGG + Intronic
1159076939 18:63691053-63691075 CAGCTAACACAGTGCTAAGAGGG + Intronic
1159562540 18:70010577-70010599 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1159663459 18:71128331-71128353 CAGCTAACTCAGTGCTTACAGGG - Intergenic
1159747533 18:72256208-72256230 CAGCTAAAATAGCGCCTACAGGG + Intergenic
1159793576 18:72815007-72815029 TTGCTAAAGCAGAACTTACAGGG + Intronic
1159902050 18:74056213-74056235 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1159974288 18:74691696-74691718 CTACAAAAGCAGAGCTTACAGGG - Intronic
1160275666 18:77431777-77431799 TTGCTAAAATAGCGCTTACAGGG - Intergenic
1161382822 19:3975343-3975365 CCTCTAAAAAAGTGTTTACAAGG + Intergenic
1161564416 19:4992418-4992440 CAGCTAAAGCAGTACTTAGAGGG - Intronic
1161883939 19:6978747-6978769 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1164008914 19:21179513-21179535 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1164152098 19:22563503-22563525 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1164224906 19:23235457-23235479 CTATTAAACCAGTGCTTGCAGGG - Intronic
1164790703 19:30977157-30977179 CAGCAGAAACAGTGCTTACAGGG - Intergenic
1164815443 19:31197297-31197319 CAGCAAAAGCAGTGCTTACAGGG + Intergenic
1164935965 19:32212827-32212849 CAGCTAAAGCAGTGCTGAGAGGG + Intergenic
1165593791 19:36994066-36994088 CAGCTAAAGCAGGGCTTAAAGGG - Intronic
1165647022 19:37448978-37449000 CAGCTAAATTAGTGCATACAGGG - Intronic
1165971593 19:39636097-39636119 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1166620613 19:44296964-44296986 CTGCAAAAACAGTGCTAAGGGGG + Intronic
1168488680 19:56788257-56788279 CAGCTAAAGCAGTGTTTACAGGG - Intronic
1168600866 19:57717507-57717529 CTGCTAAAGCAGTACTTACAGGG + Intronic
925247929 2:2401295-2401317 CTGCAAAAGCAGTGCTGACCGGG - Intergenic
925467292 2:4118326-4118348 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
925523079 2:4769480-4769502 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
925566465 2:5259624-5259646 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
925728822 2:6901974-6901996 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
925962748 2:9033764-9033786 CTGCTAAAACAGTGCTCATTGGG - Intergenic
926508863 2:13748139-13748161 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
926612935 2:14965024-14965046 CTGATAAAGCAGTACTTAAAAGG + Intergenic
926707210 2:15845385-15845407 CAGCTCCAGCAGTGCTTACAGGG + Intergenic
926841230 2:17082639-17082661 CAGCTAAGACAGTGCTAAAATGG - Intergenic
926960160 2:18348599-18348621 CAGCTAAAGCAGTTCTTAGAGGG - Intronic
926970356 2:18461362-18461384 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
927033382 2:19146448-19146470 CAACTAAAGCAATGCTTACAGGG + Intergenic
927183085 2:20461616-20461638 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
927390748 2:22592271-22592293 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
927983846 2:27393522-27393544 CTGCTTCAACAGTGCTTGGACGG - Intronic
928250044 2:29668403-29668425 ATGACAAAACAGTGCTAACAGGG - Intronic
928286975 2:29999734-29999756 CAGCTAAAGCAGTGCTTAGAAGG + Intergenic
928291689 2:30044252-30044274 TAGCTAAAACAATGCTTAGAGGG - Intergenic
928491433 2:31788011-31788033 CAGTGAAAACAGTGCTTAGAGGG + Intergenic
928535970 2:32241856-32241878 CAGCTAACACAGTGCTTACAGGG + Intronic
928750947 2:34469498-34469520 CGGCTAAAGCAGTGTTTAGAGGG + Intergenic
928813520 2:35259218-35259240 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
928847536 2:35695736-35695758 CAGCAAAAGCAGTGCTAACAGGG - Intergenic
928900326 2:36310827-36310849 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
929062620 2:37939047-37939069 CAGCTAAAGCAGTGATTAGAGGG - Intronic
929255845 2:39810842-39810864 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
929710200 2:44258829-44258851 CAGCTAAGGCAGTGTTTACAGGG + Intergenic
930161289 2:48159033-48159055 CGGCAAAAACAGTGCTGAAAGGG + Intergenic
930318426 2:49825485-49825507 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
930359615 2:50361103-50361125 CAGCTAAAGCAGTGTTTACAGGG + Intronic
930477019 2:51894309-51894331 CAGCTAAATCAGTGTTTAGAGGG + Intergenic
931074249 2:58691490-58691512 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
931211810 2:60204475-60204497 CAGCTAAAGCAGTGATTAGAGGG - Intergenic
931268155 2:60678806-60678828 CTCCTGAAACTGTGGTTACAAGG - Intergenic
931478853 2:62619560-62619582 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
931566922 2:63624174-63624196 CTGCTAAAGTAGTGTTTAAAGGG + Intronic
931815175 2:65893263-65893285 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
932536170 2:72598404-72598426 GAGCAGAAACAGTGCTTACAGGG + Intronic
933110522 2:78394568-78394590 CAGCTAAAGCAGTGCTAAGAGGG - Intergenic
933132428 2:78689276-78689298 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
933412910 2:81948341-81948363 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
933487999 2:82947740-82947762 CAGATAAAGCAGTGTTTACAGGG - Intergenic
933567124 2:83964025-83964047 CAACTAAAGCAGTGCTTACAGGG - Intergenic
933655436 2:84882794-84882816 TAGCTAAAGCAGTGCTTATAGGG - Intronic
933680806 2:85098759-85098781 CAGCAATAGCAGTGCTTACAGGG + Intergenic
933855140 2:86406245-86406267 CAGCTAAAATAGTGCTTAGAAGG + Intergenic
933857073 2:86425724-86425746 CAGCAAAAACAGTGCTCAGAGGG + Intergenic
934113267 2:88761992-88762014 TAGCTAAAGCATTGCTTACAGGG - Intergenic
934986428 2:98889999-98890021 CAGTTAAAACAATGCTTGCAAGG + Intronic
935001843 2:99025740-99025762 CAGCTAAAGCAGTACTTAGAGGG - Intronic
935374695 2:102382960-102382982 CAGCTAAAGTAGTGTTTACAGGG - Intronic
935489102 2:103695450-103695472 CAGCTAAAGCAGTGCTAAGAGGG - Intergenic
935961766 2:108432352-108432374 CAGCTAAAACAGTGTTTAGAGGG + Intergenic
935985752 2:108671514-108671536 ATGCTTAAACATTGCTTGCACGG + Intronic
936138182 2:109915144-109915166 ATGCTTAAACATTGCTTGCACGG + Intergenic
936206514 2:110456341-110456363 ATGCTTAAACATTGCTTGCACGG - Intronic
936274298 2:111080370-111080392 CAGCTAAAGCAGTGGTTAGAGGG - Intronic
936379474 2:111971461-111971483 CAGCTAAAGCAGTGCTTACAGGG - Intronic
936640001 2:114301460-114301482 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
936769260 2:115892237-115892259 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
936823104 2:116547646-116547668 CAGCTAGAACAATGCTTAGAGGG - Intergenic
937020788 2:118652279-118652301 CAGCAAAAACAGTGCTCAGAGGG + Intergenic
937502486 2:122494973-122494995 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
937621096 2:123987198-123987220 ATACTAAAACAGTTCTTAGAGGG + Intergenic
938221437 2:129571818-129571840 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
938575598 2:132600240-132600262 CTGCAAAAACAGTGGTAAGAGGG + Intronic
938951983 2:136263583-136263605 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
939248113 2:139651143-139651165 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
939381762 2:141445574-141445596 CAGCTAACACAGTGTTTAGAGGG - Intronic
939640561 2:144635806-144635828 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
939793816 2:146616383-146616405 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
940054274 2:149497418-149497440 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
940083971 2:149837246-149837268 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
940142023 2:150502025-150502047 CAGCTAAAACAGCACTTAAAAGG - Intronic
940302990 2:152195254-152195276 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
940407764 2:153325648-153325670 TAGCTAAAGCAGTGTTTACAGGG - Intergenic
940411036 2:153363223-153363245 CTGCTAAAGCAGTGTTAACAGGG + Intergenic
940721566 2:157288095-157288117 CTGTAAAAGCAGGGCTTACAGGG - Intronic
940732270 2:157406262-157406284 CAGCAAAAGCAGTGCTTACTGGG - Intergenic
940758232 2:157707465-157707487 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
940853480 2:158710219-158710241 CTGCTAAAACAGTGCCAAGAAGG - Intergenic
940881387 2:158950353-158950375 CTGCTAAAACAGACCTAATAGGG + Intergenic
940934291 2:159473712-159473734 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
940950641 2:159669102-159669124 TAGATAAAGCAGTGCTTACAGGG - Intergenic
941239033 2:163014242-163014264 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
941276874 2:163500657-163500679 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
941571358 2:167174735-167174757 CAGATAAAACAGTGTTTAGAGGG - Intronic
941608753 2:167634189-167634211 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
941659041 2:168176260-168176282 TTGCTAAAACACTGCAAACAAGG + Intronic
941945758 2:171095121-171095143 AAGTTAAAGCAGTGCTTACAGGG + Intronic
942411338 2:175712105-175712127 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
942732923 2:179079193-179079215 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
942899055 2:181092200-181092222 CGGCTAAAGCAGTGTTTAGAGGG + Intergenic
943038192 2:182771971-182771993 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
943044192 2:182839057-182839079 CTGATAAAACAGTGTCGACAAGG - Intronic
943047638 2:182877474-182877496 CGGCTAAAGCAGTGTTTAGAGGG + Intergenic
943209253 2:184941722-184941744 TTGCTAAGATATTGCTTACATGG + Intergenic
943296372 2:186145328-186145350 CCACTAAAACAGTGTTAACAGGG + Intergenic
943306343 2:186267113-186267135 CAGCTAACACAGTGGTTAGAGGG + Intergenic
943408486 2:187517296-187517318 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
943410074 2:187535574-187535596 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
943630017 2:190240638-190240660 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
943698135 2:190958570-190958592 CAGCTAAAGCAGTGTTTAGAAGG - Intronic
943837117 2:192527466-192527488 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
944275413 2:197831995-197832017 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
944292333 2:198021238-198021260 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
944635484 2:201672236-201672258 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
944956403 2:204815666-204815688 CTGCTAAAGCAGCACTTAGAAGG - Intronic
945329454 2:208522705-208522727 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
945343933 2:208690032-208690054 CAGCTAAAACAGTGTTAAGAGGG - Intronic
945389285 2:209244438-209244460 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
945400151 2:209372000-209372022 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
945409475 2:209491286-209491308 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
945434296 2:209800708-209800730 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
945533226 2:210981948-210981970 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
945845649 2:214941115-214941137 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
945945500 2:215991381-215991403 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
946065025 2:216979870-216979892 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
946463717 2:219892925-219892947 CAGCTGAAACAATGCTTTCAAGG - Intergenic
946533013 2:220593753-220593775 CAGCTAAGGCAGTGCTTACAGGG + Intergenic
947086327 2:226456913-226456935 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
947122511 2:226832149-226832171 CAGCTAAAACAGTGATCAAAAGG - Intergenic
947364958 2:229384250-229384272 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
947600620 2:231447083-231447105 CAGCTAAAGCAGTTCTTAGATGG - Intergenic
948007996 2:234626491-234626513 CAGCTAAAATCGTGCTTAGAGGG - Intergenic
948181747 2:235987658-235987680 CCGCTAAAACAGTGTTCAGAGGG - Intronic
948517830 2:238516291-238516313 CCACTAAAGCAGTGCTTAGAGGG - Intergenic
948573367 2:238932217-238932239 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
1168933217 20:1641743-1641765 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1169645946 20:7810014-7810036 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1169960056 20:11149943-11149965 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1170011747 20:11731005-11731027 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1170229078 20:14025495-14025517 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1170283344 20:14676556-14676578 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1170294521 20:14809424-14809446 CAGCTAAAACAGTGTTTAGAGGG + Intronic
1170633710 20:18086615-18086637 TAGCTAACACAGTACTTACAGGG - Intergenic
1170727040 20:18939006-18939028 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1171362261 20:24596107-24596129 CAGCTAAAACAGTGCAAAGAGGG - Intronic
1171441691 20:25168925-25168947 CAGCTAAAGCGGTGTTTACAGGG + Intergenic
1173149668 20:40555715-40555737 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1173291108 20:41716074-41716096 CTGCTTTAACACTGCTCACAAGG - Intergenic
1173750870 20:45475329-45475351 CAGCTAAAGCAGTGCTTAGAAGG - Intronic
1174692571 20:52522536-52522558 CTGCTAAAACGGAACTTAGAGGG - Intergenic
1174844630 20:53931569-53931591 CAGCTAAAGCTGTGCTTATAGGG - Intergenic
1174845420 20:53938650-53938672 CTGCTAAAACACAGGTTACTGGG + Intronic
1174968402 20:55245945-55245967 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1175041242 20:56052876-56052898 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1176892066 21:14330155-14330177 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1177050554 21:16227601-16227623 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1177092174 21:16782780-16782802 CAGCTAAAGCAGTGATTAGAGGG + Intergenic
1177398538 21:20569992-20570014 TAGCTAAAACAATGCTTAGAGGG + Intergenic
1177694865 21:24557803-24557825 CAGCTAAAACAGTGTTTAGAGGG + Intergenic
1177764045 21:25436463-25436485 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1178039235 21:28621216-28621238 CAGCTAACACAGTGTTTAGAGGG - Intergenic
1178146006 21:29740755-29740777 CTGCTAAAAGATTTGTTACATGG + Intronic
1178393944 21:32223116-32223138 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1179004603 21:37501104-37501126 CAGCTAAAGCAGTGCTTGGAGGG - Intronic
1179008726 21:37536667-37536689 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1179009307 21:37543221-37543243 CAGCTATAACAGTGCATAGAGGG + Intergenic
1179366374 21:40761950-40761972 CAGCTAAGGCAGTGTTTACAGGG + Intronic
1179929909 21:44560822-44560844 CAGCTAAAGCAGTGTTAACAGGG + Intronic
1180134221 21:45851008-45851030 CAGCTAAAGCAGTGCTTAGAAGG + Intronic
1180599203 22:17003669-17003691 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1180974064 22:19835902-19835924 CAGCTAAAACAGTGCTTAGAGGG + Intronic
1182870583 22:33643386-33643408 CAGCTAAAGCAGTGTTTATAGGG + Intronic
1183564720 22:38605585-38605607 CCGCTAAAGCAGTGTTTAGAGGG + Intronic
1183757397 22:39781501-39781523 CAGCAAAAACAGTGCTAAGAAGG + Intronic
1183837757 22:40470434-40470456 CAGCTGAAACAGTGCTTAGAGGG + Intronic
1184308038 22:43621544-43621566 CAGCTAAATCAGTGCCTACGGGG + Intronic
1184380194 22:44140566-44140588 CTGCTAAACCAGTGGTTTCCAGG - Intronic
1184740465 22:46425920-46425942 CAGCTAAAGCAGTGCTGAGAGGG - Intronic
1184967021 22:47985314-47985336 CTGTTAAAGCAATGCTCACAAGG - Intergenic
1185174786 22:49319486-49319508 CTGCAAAAGCAGTGCTTAGAGGG - Intergenic
1185231102 22:49683655-49683677 TGGCTAAAGCAGTGCTTAGAGGG - Intergenic
949175772 3:1060963-1060985 CAGCTAAAACAGTGTTTAGAGGG - Intergenic
949217887 3:1592743-1592765 CAGCTAAAGCAGTGCTTAAGAGG + Intergenic
949223098 3:1659452-1659474 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
949432877 3:3996951-3996973 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
949521789 3:4862613-4862635 AAGCTAAAGCAGTGCTTAAAAGG - Intronic
949580324 3:5381749-5381771 CAGCTAAAGCAATGTTTACAGGG - Intergenic
949583681 3:5415739-5415761 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
949586581 3:5445565-5445587 TTGCTAAAGCAGTGCTTATAGGG - Intergenic
949640763 3:6033580-6033602 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
949921147 3:9002428-9002450 CAGCTAAAGCAGTGCTTAGAAGG + Intronic
949955342 3:9263207-9263229 CAGCTAAAGCAGTGCTTAAAGGG + Intronic
950625116 3:14240254-14240276 CAGCTAACACAGTGCTGAGAAGG - Intergenic
951193717 3:19801214-19801236 CAAATAAAACAGTGCTTAGAAGG + Intergenic
951311188 3:21127869-21127891 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
951432588 3:22625667-22625689 CAGCTAAATCAGTGTTAACAGGG - Intergenic
951435495 3:22657931-22657953 CAGCTAAAACAGTCGTTAGAAGG + Intergenic
951446448 3:22786509-22786531 CAGCAAAAGCAGTGCTTAGATGG + Intergenic
951450245 3:22829313-22829335 CAGCTAAATCAGTGTTTAGAGGG + Intergenic
951549236 3:23860341-23860363 CAGCTAAAACATTGCTAAAAAGG - Intronic
951628826 3:24696582-24696604 CTGCTAAAGCAGTGTTTAGAGGG - Intergenic
951676162 3:25244463-25244485 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
951795094 3:26529961-26529983 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
951826941 3:26878847-26878869 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
951924590 3:27894766-27894788 CGGCTAAAGCAGTGCTCAGAGGG + Intergenic
952098339 3:29982567-29982589 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
952194457 3:31059100-31059122 CTGCTAAAGCTGTATTTACAGGG - Intergenic
952611753 3:35218014-35218036 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
953074345 3:39554187-39554209 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
953082207 3:39631489-39631511 TTGCTAAAACAATGCTTAGGAGG + Intergenic
953092314 3:39741117-39741139 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
953195533 3:40729240-40729262 CAGCTAAAGCAGTGCTAAGAGGG - Intergenic
953204387 3:40810184-40810206 CAGCAAAAGCAGTGCTCACAGGG - Intergenic
953264561 3:41373626-41373648 CTGCTAAAGCAGTGTTTAGAGGG + Intronic
953270740 3:41441299-41441321 CTCCTAAAACAGTACTTAGGGGG - Intronic
953286938 3:41619605-41619627 CAGCTAAAGCAGTGCTTACAGGG + Intronic
953316157 3:41928340-41928362 CTGCTAAAGCAGTGTGTAGAGGG + Intronic
953433688 3:42860852-42860874 CAGCTAAAGCAGTGTTTACAGGG + Intronic
953554942 3:43937589-43937611 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
953818081 3:46178592-46178614 CAGCAAAAACAGTGCTAAGAGGG - Intronic
954050165 3:47968578-47968600 CAGCTAAAACAGTGGTAAGAGGG + Intronic
954093523 3:48303608-48303630 CTGCTAAAGCCTTGCTTAGATGG + Intergenic
955453679 3:59097655-59097677 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
955462464 3:59199093-59199115 CTGCTAAAGCCATACTTACAGGG - Intergenic
956110773 3:65867952-65867974 CTGATAGATCAGTGGTTACAAGG - Intronic
956197202 3:66664838-66664860 CTGATAAATCAGTGCCTGCAAGG + Intergenic
956356003 3:68392846-68392868 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
956656792 3:71560073-71560095 GTGCTAAAACAGTGTTGTCAGGG - Intronic
956818275 3:72928878-72928900 CTGCTTCAACAGTGCTTGGACGG + Intronic
956910115 3:73808122-73808144 TTGCCAAAACAGGGGTTACAGGG - Intergenic
957108321 3:75920180-75920202 CAGGTAAAACAGTGTTTAGAGGG - Intronic
957236294 3:77596603-77596625 CGGCTAAAACAGAAATTACAAGG - Exonic
957370936 3:79293530-79293552 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
957696132 3:83639850-83639872 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
957908148 3:86583974-86583996 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
957992961 3:87651017-87651039 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
958523643 3:95224334-95224356 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
958586533 3:96094212-96094234 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
958694291 3:97508314-97508336 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
958775770 3:98481139-98481161 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
958849643 3:99308693-99308715 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
959422654 3:106148350-106148372 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
959428394 3:106221557-106221579 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
959451255 3:106505551-106505573 CAGCTGAAACATTGCTTAGAAGG - Intergenic
959534885 3:107473356-107473378 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
959848366 3:111059655-111059677 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
959898279 3:111630002-111630024 CAGCTAAAGCAGTGCTAAGAAGG + Intronic
960226560 3:115176083-115176105 CTGTAAAAGCAGTGCTTACAGGG + Intergenic
960278472 3:115753881-115753903 TAGCTAAAGCAGTGTTTACAGGG + Intergenic
960491289 3:118319423-118319445 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
960580108 3:119270178-119270200 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
960642798 3:119844163-119844185 CAGCTAAAGCAGTGTTTAAAGGG + Intronic
960729016 3:120703428-120703450 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
960759811 3:121061123-121061145 CAGCTAAAGCAGTGTTTAGATGG - Intronic
960776808 3:121265461-121265483 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
960881251 3:122347801-122347823 CAGCTAAAGCAATGCTTAGAGGG - Intergenic
960895599 3:122501364-122501386 CAGCTAAAGCAGTGCTTAAAGGG - Intronic
961335416 3:126174742-126174764 CTGCTAAAGTAGTGTTTAGAGGG + Intronic
961587124 3:127940563-127940585 CTGCTAAAGCAGTGTTTAGAAGG + Intronic
961703458 3:128765163-128765185 CTGCTTCAACAGTGCTTGGACGG - Intronic
961997950 3:131266359-131266381 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
962092483 3:132259616-132259638 CAGCTAAAATAGTACTTAAAAGG + Intronic
962175283 3:133147112-133147134 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
962641727 3:137394082-137394104 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
963264261 3:143224076-143224098 CTCCCCAAACAGTGCTTAAATGG - Intergenic
963360079 3:144260846-144260868 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
963551398 3:146728467-146728489 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
963629012 3:147710257-147710279 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
964053428 3:152422937-152422959 CAGCTAAAGCAGTGTTTACAGGG + Intronic
964093636 3:152905247-152905269 CAGCTAAATCAGTGCTGAGAGGG + Intergenic
964435602 3:156648927-156648949 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
964560963 3:157995641-157995663 CAGATAAATCAGTGCTTAGAAGG - Intergenic
964566939 3:158067090-158067112 CAGCTAAAGCAGTGCTTACAGGG + Intergenic
964614460 3:158647796-158647818 ATGCTAAAACAGTGTTTCCTTGG - Intronic
964701450 3:159572272-159572294 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
964905115 3:161710044-161710066 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
965002064 3:162966864-162966886 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
965036611 3:163447488-163447510 CTGCTAAAACAGTGTTAAGAGGG + Intergenic
965162172 3:165148036-165148058 CAGATAAAACAGTGCTGAGAGGG + Intergenic
965217794 3:165885986-165886008 CTGCTTAAACAATGGTTAGATGG + Intergenic
965493991 3:169375163-169375185 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
965718968 3:171640315-171640337 CAGCTATAGCAATGCTTACAGGG - Intronic
965880743 3:173385135-173385157 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
966133851 3:176675820-176675842 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
966309700 3:178579359-178579381 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
966341486 3:178929768-178929790 CAGCTAAGACAGTGTTTAGAGGG + Intergenic
966433053 3:179852790-179852812 CTGTGAAAACATTGCTTAAAAGG + Intronic
966474911 3:180333459-180333481 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
966621581 3:181969848-181969870 TTACTAAAACTCTGCTTACAGGG + Intergenic
967282415 3:187834940-187834962 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
967343375 3:188426103-188426125 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
967619346 3:191613976-191613998 CAGCTAAAGCAGTGTTTAGATGG - Intergenic
968828768 4:2919990-2920012 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
968971095 4:3794864-3794886 TTGCTTAAACAGTGCTTAGAGGG + Intergenic
969123487 4:4927585-4927607 CAGCTAAACCAGTGTTTAGAGGG + Intergenic
969970746 4:11045417-11045439 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
970214252 4:13742550-13742572 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
970304963 4:14721712-14721734 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
970339523 4:15090399-15090421 CAGCTAAAGCAGTGCTGAGAGGG - Intergenic
970749491 4:19340449-19340471 CAGCTAACACAGTGTTTAGAGGG - Intergenic
970806120 4:20035358-20035380 CAGCTAAAACAGTGCTGAGAGGG + Intergenic
971071774 4:23102734-23102756 CAGCTAAAGCAGTGCTCAAAAGG - Intergenic
971186740 4:24385232-24385254 CCGCTAAAGCAGTGTTTAGAGGG + Intergenic
971279733 4:25233346-25233368 CAGCTAAAGCAGTGCTTAGAGGG + Intronic
971429773 4:26553662-26553684 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
971521827 4:27562190-27562212 CAGCTAAAGCAGTTCTTAAAGGG + Intergenic
971698156 4:29932838-29932860 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
971974421 4:33665305-33665327 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
971989046 4:33867224-33867246 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
972069564 4:34999242-34999264 CAGCAAAAACAATGCTTAGAAGG - Intergenic
972122103 4:35716266-35716288 CTGCAAAAGCAGTGCTAACAGGG + Intergenic
972742696 4:41903749-41903771 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
973251093 4:48060808-48060830 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
973609082 4:52616964-52616986 CAGCTAAACCAATGCTTAAAGGG + Intronic
973629391 4:52804978-52805000 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
973950133 4:56004058-56004080 CAGCAAAAACAGTGCTAAGAGGG - Intronic
974572207 4:63667639-63667661 CTGCTAAGACAGTGATAAGAGGG - Intergenic
974946338 4:68533592-68533614 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
975104406 4:70551572-70551594 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
975178196 4:71311674-71311696 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
975483892 4:74913350-74913372 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
975513973 4:75224336-75224358 CAGCTAAAGTAGTGTTTACAGGG + Intergenic
975524562 4:75334512-75334534 CAGCTAAAGCAATGCTTAGAGGG + Intergenic
975764974 4:77657691-77657713 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
975925901 4:79453134-79453156 CTACGAAAAAAGTGTTTACAGGG - Intergenic
976007091 4:80442546-80442568 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
976065837 4:81186462-81186484 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
976099286 4:81543367-81543389 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
976156841 4:82154954-82154976 CAGCTAAAGCAGTGCGTACAGGG + Intergenic
976166532 4:82261857-82261879 CAGCTAAAATAGTACTTAGAGGG - Intergenic
976210098 4:82659482-82659504 CAGCTAAACCAGTGTTTAGAGGG - Intronic
976323311 4:83741628-83741650 CTGCTGAAGCAGTACTTAGAGGG + Intergenic
976355829 4:84116683-84116705 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
976363332 4:84205618-84205640 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
976371125 4:84289396-84289418 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
976449635 4:85173400-85173422 CAGCTAAAGCAGTGCTGAAAGGG + Intergenic
976534042 4:86190896-86190918 CAGCTAAAGCAGTGGTTAGAGGG - Intronic
976548999 4:86372752-86372774 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
976655643 4:87486217-87486239 CAGCTAAAACACTGTTTAGAGGG - Intronic
976669788 4:87639255-87639277 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
976903299 4:90206349-90206371 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
977047176 4:92081946-92081968 CAGCTAAAGCAGTGATTAGAGGG + Intergenic
977154769 4:93558077-93558099 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
977185367 4:93930043-93930065 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
977188801 4:93974305-93974327 CAGCTAAAGCAGTGCTTGGAGGG - Intergenic
977247270 4:94648004-94648026 CAGCTAAAGCAGTGCTTAGATGG + Intronic
977337183 4:95714155-95714177 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
977425835 4:96865844-96865866 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
977606158 4:98986998-98987020 CTGTTTACACAGTGCTTTCATGG + Intergenic
977632693 4:99260949-99260971 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
977671673 4:99702053-99702075 CAGCTAAAACAGTGTTTACAGGG + Intergenic
977888166 4:102275975-102275997 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
977892692 4:102330010-102330032 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
978023707 4:103846497-103846519 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
978110584 4:104960223-104960245 CAGCAAAAACAGTGCTAAGAGGG - Intergenic
978116938 4:105030659-105030681 CAGCTAAAACAGTGTTTAGAGGG + Intergenic
978179249 4:105773510-105773532 CAGCTAAAGCAGTGTTAACAGGG - Intronic
978278043 4:106975891-106975913 CAGCTAAAGCAGTGTTTAGAAGG - Intronic
978476980 4:109142078-109142100 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
978551902 4:109936691-109936713 CAGCTAAAGCAGTGTTTATACGG - Intronic
978665823 4:111180999-111181021 CAGTGAAAGCAGTGCTTACAGGG - Intergenic
978694393 4:111559371-111559393 CAGCCAAAACAGTGTTTAGAGGG - Intergenic
979009757 4:115352788-115352810 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
979022574 4:115522220-115522242 CTGCTAAAGCAGTGTTTAGAGGG - Intergenic
979417721 4:120463598-120463620 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
979461341 4:120987867-120987889 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
979698023 4:123636416-123636438 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
979791820 4:124793156-124793178 CAGCTAAAACAGTACTAAGAGGG - Intergenic
979819149 4:125149544-125149566 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
980328355 4:131378314-131378336 CAGCCAAAACAGTACTTAAAAGG + Intergenic
981018115 4:139995938-139995960 CAGCTAAAACAGTGCTTAGATGG - Intronic
981133695 4:141187005-141187027 CAGCTAAAGCAGTGTTTCCAGGG - Intronic
981142748 4:141288989-141289011 ATGCAAAATCAGTGCTAACATGG - Intergenic
981330895 4:143508484-143508506 CAGCTAAAACAGTGCTTAGAGGG - Intergenic
981639560 4:146924859-146924881 CAGCTAAAGCAGTGCTTAAAAGG - Intronic
981958684 4:150509393-150509415 CAGCTAAAGCAGTACTTAGAGGG + Intronic
982324170 4:154111778-154111800 CTGCTAAAGCCGTGTTTAGAGGG + Intergenic
982476675 4:155860903-155860925 CAGCTAAAACAGTGCTTATAGGG - Intronic
982628438 4:157799322-157799344 TAGCTAAAACAATGCTTAGAGGG - Intergenic
982908212 4:161105263-161105285 CTGTTAAATCAGTGTTTAAATGG + Intergenic
983044222 4:162967011-162967033 CTGCTAAAGCATTGTTTAGAGGG - Intergenic
983179725 4:164633430-164633452 CTGCTAAAGCAGTGTTAAGAGGG + Intergenic
983596019 4:169469270-169469292 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
983949174 4:173619728-173619750 CAGCTAAAGCAGTGATTAGAGGG - Intergenic
983959173 4:173731746-173731768 TAGTTAAAACAGTGCTTACAGGG + Intergenic
984335338 4:178382294-178382316 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
984440129 4:179758500-179758522 AGGCTAAAACAGTACTTAGAGGG - Intergenic
984868324 4:184303649-184303671 CTGCAAAAGCAGTACTTAAAGGG + Intergenic
984903295 4:184603973-184603995 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
985049762 4:185977747-185977769 CAGCAAAAACAGTGCTAAGAGGG + Intergenic
985204758 4:187523427-187523449 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
985340311 4:188945334-188945356 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
985359520 4:189157098-189157120 CTGATAAAACAGTGCTTAGAGGG - Intergenic
985359826 4:189161765-189161787 CTGCTACATCAGTGCTTAGAAGG - Intergenic
985565613 5:614330-614352 CAGCTAAAGCAGTGCTTACAGGG - Intronic
985787606 5:1906911-1906933 TACCTAAAACAGTGCTTAGAGGG + Intergenic
986358826 5:6955117-6955139 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
986361161 5:6979498-6979520 CTGCTATAGCAGGGCTTAGAAGG + Intergenic
986378549 5:7159978-7160000 CAGATAAAACAGTGTTTACAGGG - Intergenic
986484631 5:8223006-8223028 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
986562737 5:9079401-9079423 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
986620637 5:9669751-9669773 CAGCTAAAACAGTGTTAAGAGGG + Intronic
986665010 5:10094308-10094330 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
987229038 5:15873252-15873274 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
987399546 5:17461152-17461174 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
987598759 5:20037693-20037715 CAGCTAAAGCAGTGTTTAGATGG + Intronic
987656806 5:20817593-20817615 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
987720548 5:21627629-21627651 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
987909866 5:24127460-24127482 CAGCTAAAACAGTGTTAAGAGGG - Intronic
988116305 5:26896658-26896680 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
988195881 5:28004956-28004978 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
988719484 5:33862018-33862040 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
988766746 5:34386356-34386378 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
988892487 5:35632707-35632729 CAGCTGAATCAGTGCTTAGAGGG - Intronic
989029084 5:37098874-37098896 CAGCAAAAGCAGTGCTAACAGGG + Intergenic
989222816 5:38987857-38987879 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
989324702 5:40178634-40178656 CAGCTAAAGCAGTGGTTAGAGGG + Intergenic
989364220 5:40637449-40637471 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
989657154 5:43757247-43757269 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
989674966 5:43963098-43963120 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
989696304 5:44204803-44204825 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
989825607 5:45850754-45850776 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
989840803 5:46065797-46065819 CTAGAAAAACAGTGTTTACAAGG - Intergenic
990099138 5:52159683-52159705 CCGCTAAAGCAGTGTTTAGAGGG + Intergenic
990195298 5:53308314-53308336 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
990570862 5:57077186-57077208 CAGCGAAAGCAGTGCTTAGAGGG - Intergenic
990803783 5:59634726-59634748 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
991223856 5:64246107-64246129 CAGCTAAAGCAGTGTTTAAAGGG + Intronic
991242613 5:64476982-64477004 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
991282948 5:64937248-64937270 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
991525546 5:67553175-67553197 ATGCTAAAACAGTGTTTACAGGG - Intergenic
992055004 5:72980097-72980119 CAGCTGAAACAGTGTTTAGAGGG - Intronic
992288209 5:75257288-75257310 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
992292063 5:75289795-75289817 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
992383550 5:76262582-76262604 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
992523484 5:77581837-77581859 CAGCTAAAGCAGTGCTTAGAAGG + Intronic
992586636 5:78246966-78246988 TAGGTAAAACAGTACTTACAAGG - Intronic
992740331 5:79767454-79767476 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
992897712 5:81260209-81260231 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
992991226 5:82285668-82285690 CAGCTCAAGCAGTGCTTAGAGGG - Intronic
993241954 5:85400992-85401014 CAGCAAAAACAGTGCTTAGTGGG + Intergenic
993403836 5:87486761-87486783 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
993410301 5:87565779-87565801 CAGCTAAAGCAATGTTTACAGGG - Intergenic
993469282 5:88287121-88287143 TTGCCAAAAGAGTGCTTAAATGG + Intergenic
993541871 5:89161828-89161850 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
993589852 5:89780768-89780790 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
993609295 5:90034501-90034523 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
993623150 5:90191805-90191827 CTGCTTAAACTGTGTTAACATGG - Intergenic
993634075 5:90323371-90323393 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
993674243 5:90797918-90797940 CAGCTAACACAGTGTTTAGAGGG + Intronic
993802199 5:92356370-92356392 CTGCTAAAGCAATGATTAGAGGG - Intergenic
993895263 5:93525846-93525868 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
993960645 5:94293262-94293284 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
994004798 5:94825190-94825212 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
994129706 5:96212277-96212299 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
994245732 5:97473024-97473046 CAGCTAAAACAGTGTTTTGAGGG + Intergenic
994617615 5:102125796-102125818 CAGCAAAAGCAGTGTTTACAAGG - Intergenic
994708675 5:103238295-103238317 CAGCTAAAGCAGTGCTTAGAAGG + Intergenic
994721292 5:103383350-103383372 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
994834302 5:104829761-104829783 CAGCTAACACAGTGTTTACAGGG - Intergenic
994850753 5:105052381-105052403 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
994991025 5:106997416-106997438 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
995005450 5:107188755-107188777 CAGCTAAAACAGTTCTCAGAGGG + Intergenic
995211168 5:109541005-109541027 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
995325946 5:110890194-110890216 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
995464687 5:112438952-112438974 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
995475315 5:112541951-112541973 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
995571384 5:113486084-113486106 CAGGTAAAACTGTGCTTACCAGG + Intronic
995738677 5:115331114-115331136 CAGCTAAAGCAGTGCTGAAAGGG - Intergenic
995983113 5:118132444-118132466 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
996194062 5:120581670-120581692 CAGCTAAAGCAGTGTTAACAGGG - Intronic
996271072 5:121605144-121605166 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
996458318 5:123710617-123710639 CAACTAAAACAGTGCTTACAGGG - Intergenic
996809433 5:127499124-127499146 TAGCTAAAGCAGTGCTTAAAAGG + Intergenic
997156629 5:131567411-131567433 CAGCTAAAGCAGTACTTTCAGGG - Intronic
997171531 5:131726814-131726836 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
997385452 5:133468594-133468616 CTGCTGATACAATGCTGACATGG - Intronic
997807314 5:136931462-136931484 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
997876098 5:137548637-137548659 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
998035342 5:138910609-138910631 CAGCTAAAACAGTGCTTCGAGGG - Intronic
998101252 5:139436804-139436826 CAGCTAAAACAGTGCTTAGAAGG - Intronic
998113019 5:139516650-139516672 CTCCTAAAACAGTGCTTAAGTGG - Intergenic
998961667 5:147494202-147494224 TAGCTAAAGCAGTGCTTAGAGGG + Intronic
998972494 5:147608325-147608347 CAGCTAAAACAGTGTTTAGAGGG - Intronic
999185548 5:149705289-149705311 CAGCCAAATCAGTGCTTAGAGGG - Intergenic
999225137 5:150015631-150015653 CCACTAAAGCAGTGCTTAGAGGG - Intronic
999607914 5:153336575-153336597 CAGCTAAAGCAGTGTTTAGATGG - Intergenic
999688599 5:154125153-154125175 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1000375854 5:160581301-160581323 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1000555937 5:162725926-162725948 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1000653908 5:163852820-163852842 CAGCTAAAGCAGTGCTTAAAGGG - Intergenic
1000808462 5:165828344-165828366 CAGCTAAAGCAGTGATTAGAGGG - Intergenic
1000860139 5:166447676-166447698 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1000995775 5:167957625-167957647 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1001346101 5:170900665-170900687 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1001895835 5:175379795-175379817 CAGCTAAATCAGTGCTTAGAGGG + Intergenic
1001898885 5:175405989-175406011 CAGCTAAAACTGTGCTCAGAAGG + Intergenic
1002007715 5:176250070-176250092 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1002218662 5:177660559-177660581 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1002945136 6:1753873-1753895 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1003037401 6:2655647-2655669 CAGCTAAAGCAGTGGTTAAAGGG + Intergenic
1003416605 6:5915007-5915029 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1003713297 6:8617720-8617742 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1003992705 6:11502494-11502516 CGGCTAAAACAGTGTTGAGAAGG - Intergenic
1004565725 6:16795259-16795281 ATGCTAAAGCAATGCTGACAGGG + Intergenic
1004593543 6:17076747-17076769 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1004800567 6:19142415-19142437 CTGCCAAAACCGTGTTTACCAGG + Intergenic
1005110531 6:22276632-22276654 CAGCTAAAGCAGTGCTGAAAAGG - Intergenic
1005208240 6:23429894-23429916 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1005274486 6:24201492-24201514 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1005785568 6:29242130-29242152 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1006266235 6:32926857-32926879 CAGCTAAACCAGTGCTGAAAGGG + Intergenic
1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG + Intergenic
1007268578 6:40617683-40617705 CAACTAAAGCAGTGCTTAGAGGG - Intergenic
1007411534 6:41665001-41665023 CAGCTAAAACAGTAGTTAGAGGG + Intergenic
1007458899 6:42002510-42002532 CAGCTAAAACAACACTTACAGGG + Intronic
1007858428 6:44881875-44881897 CAGCTAAAGCAGTGATTAGAGGG + Intronic
1008156664 6:48023790-48023812 CTCCCAAAACTGTTCTTACAAGG + Intronic
1008360834 6:50616424-50616446 CAGCTACAACAGTGCTGATAGGG + Intergenic
1008719425 6:54330445-54330467 CAGCTAAAACAGTGTTTAGAGGG + Intronic
1009193802 6:60661100-60661122 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1009399269 6:63234928-63234950 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1009446363 6:63747084-63747106 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1009755144 6:67929436-67929458 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1009776805 6:68215780-68215802 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1009959209 6:70498627-70498649 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1010008346 6:71021701-71021723 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1010477170 6:76302156-76302178 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1010532050 6:76980449-76980471 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1010647540 6:78409590-78409612 CATCTAGAACAGTGTTTACAGGG + Intergenic
1010668024 6:78652982-78653004 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1010936877 6:81872607-81872629 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1010962935 6:82167384-82167406 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1010994293 6:82515249-82515271 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1011020401 6:82806636-82806658 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1011147677 6:84236564-84236586 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1011201417 6:84840805-84840827 CAGCTAAAGCAGTGTTTAGACGG - Intergenic
1011213790 6:84983031-84983053 CAGCTAAAACAGTGTGTAGAGGG + Intergenic
1011234885 6:85204975-85204997 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1011235310 6:85210300-85210322 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1011235773 6:85214785-85214807 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1011556945 6:88580219-88580241 CAGCTAAAGCAGTGCTTAGAAGG - Intergenic
1011766544 6:90626096-90626118 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1011944434 6:92883105-92883127 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1012148794 6:95719570-95719592 TAGCTAAAGCAGTGTTTACAGGG + Intergenic
1012190496 6:96273834-96273856 CAGCTAAAGCAGTGTTTAGATGG - Intergenic
1012332283 6:98008011-98008033 CAGCAAAAGCAGTGCTTAGAGGG - Intergenic
1012514348 6:100041418-100041440 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1012596838 6:101051308-101051330 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1012679819 6:102165989-102166011 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1013025328 6:106265836-106265858 CAGCTAAAGCAGTGCTAAGAGGG + Intronic
1013490863 6:110645401-110645423 CATCTAATACAGTACTTACAAGG + Intronic
1013672877 6:112424346-112424368 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1013939881 6:115648159-115648181 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1014058217 6:117041235-117041257 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1014070664 6:117177865-117177887 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1014279123 6:119420927-119420949 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1014356960 6:120424310-120424332 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1014497887 6:122149893-122149915 CTGCAAAAGCGGTGCTTAGAGGG - Intergenic
1014560356 6:122882460-122882482 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1014836241 6:126164125-126164147 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1014867011 6:126544952-126544974 CAGCTAAAACACAGATTACATGG + Intergenic
1014868505 6:126561436-126561458 CAGCTAAAGCAGTGATTAGAGGG + Intergenic
1015109202 6:129571957-129571979 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1015291378 6:131541550-131541572 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1015368306 6:132422700-132422722 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1015623106 6:135153503-135153525 CAGCTAAAGCAGTGTTTAGAAGG - Intergenic
1015667251 6:135645848-135645870 CGGCTAAAGAAGTGCTTACATGG + Intergenic
1015802355 6:137073128-137073150 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1015882989 6:137888519-137888541 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1016167954 6:140971444-140971466 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
1016242145 6:141943083-141943105 CAGCTGAAGCAGTGCTTAGAGGG + Intergenic
1016483210 6:144505404-144505426 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1016631141 6:146233252-146233274 CAGCTAAAGCAATGCTTAGAGGG - Intronic
1016638362 6:146321123-146321145 CAGCTAAAGCAGTGTTTAAAGGG - Intronic
1016663498 6:146608524-146608546 CTGCTAAAGCAGTGTTAAAAGGG - Intronic
1016816017 6:148303934-148303956 CAGCTAAAACAATGCTCAGAAGG + Intronic
1017197137 6:151713991-151714013 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1017783820 6:157737804-157737826 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1018144377 6:160869787-160869809 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
1018520828 6:164649464-164649486 CTGCCAAAGCAGTGCTGAGAGGG - Intergenic
1018558938 6:165080489-165080511 CTTCTAAAGCAATGTTTACAGGG + Intergenic
1018585860 6:165357963-165357985 CAGCTAAAACAGTGCTGAGAGGG - Intronic
1018617320 6:165699821-165699843 CAGCTAAAACAGTGCTTAAAGGG + Intronic
1019024396 6:168945998-168946020 CAGCTAAAGCAGTGCTAAGAGGG - Intergenic
1019935460 7:4253279-4253301 CAGCTAACACAGTGCTTAGAGGG - Intronic
1020362884 7:7348754-7348776 CTGCTAAAGCAGTACTTAGAAGG - Intergenic
1020366953 7:7391128-7391150 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1020487380 7:8736280-8736302 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1020565344 7:9787850-9787872 CTGCTAAGACAGTGCTGATGGGG - Intergenic
1020630077 7:10628676-10628698 CAGCTAAAACAGTGTTTAGAGGG + Intergenic
1020694437 7:11396136-11396158 CAGCTAAAACTGTGTTTAGAGGG + Intronic
1020753127 7:12168017-12168039 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1020759623 7:12252435-12252457 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1020885284 7:13812465-13812487 CGGCTAAAGCAGTGGTTAGAGGG + Intergenic
1020935704 7:14461090-14461112 CAGCTAAAGCATTGTTTACAGGG + Intronic
1021064986 7:16162328-16162350 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1021205276 7:17772617-17772639 CTATTCAAACAGTGCTTTCAAGG - Intergenic
1021304717 7:19018549-19018571 CTGTGAAAACAGTGCTAAGACGG + Intergenic
1021428137 7:20527130-20527152 CAGCGAAAGCAGTGCTTAGAGGG + Intergenic
1021474803 7:21048939-21048961 TTTCTAAAACAGTGATAACAAGG + Intergenic
1021502017 7:21342503-21342525 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1021642617 7:22754515-22754537 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1021734631 7:23630993-23631015 CAGCTAAAGCAGTGCTGAGAGGG + Intronic
1021749062 7:23776973-23776995 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1021750822 7:23797601-23797623 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1021832307 7:24627352-24627374 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1022058548 7:26767612-26767634 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1022147994 7:27566691-27566713 CTCCTAAAGCAGTGCTTGGAAGG - Intronic
1022396859 7:29996388-29996410 ATGCTAAAGCAGTGCTTAGAGGG - Intergenic
1022512174 7:30945230-30945252 CAGCTAAAGCAGTGCTTAGAGGG - Intronic
1022610782 7:31870095-31870117 CTGCAAAAGCAGTGCTAAAAGGG + Intronic
1022848183 7:34232680-34232702 CAGCTAAAGCAGTGGTTACAGGG - Intergenic
1023002006 7:35819098-35819120 CAGCTAAATCAGTGCTTAGAAGG - Intronic
1023051452 7:36255976-36255998 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1023325342 7:39049328-39049350 CATTTAAAACAGTGCTTAAAAGG - Intronic
1023697417 7:42862252-42862274 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1023894627 7:44422128-44422150 CAGCTAAAACGGTGTTAACAGGG + Intronic
1024017990 7:45335816-45335838 CTGCTAAAGCAGTGTTTAGAGGG + Intergenic
1024032621 7:45476548-45476570 CAGCTAAAATAATGCTTGCAGGG + Intergenic
1024037422 7:45520184-45520206 CAGCTAAATCAGTGCTTGGAGGG + Intergenic
1024086724 7:45898734-45898756 CAGCTGAAGTAGTGCTTACAGGG + Intergenic
1024149915 7:46560654-46560676 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1024298881 7:47870083-47870105 CAGCTAAATCAGTGCTTGAAGGG + Intronic
1024495803 7:50044154-50044176 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1024990280 7:55229252-55229274 CTGCTAAAGCAGTGCTACCAGGG - Intronic
1025042022 7:55654286-55654308 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1025525093 7:61796548-61796570 CTACAAAAACAGTGTTTCCAAGG + Intergenic
1025548473 7:62209112-62209134 CTACAAAAACAGTGTTTCCAAGG + Intergenic
1026083973 7:67247508-67247530 CTACTAAACCAGTGCTTAGAGGG + Intergenic
1026667230 7:72352633-72352655 CAGCTAAAACAGTGCTTACAAGG + Intronic
1026693059 7:72566519-72566541 CTACTAAATCAATGCTTAGAGGG - Intronic
1027563420 7:79761107-79761129 CAGTTAAAACAGTGTTTAGAGGG + Intergenic
1027583162 7:80023100-80023122 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1027864277 7:83626857-83626879 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1027910455 7:84243750-84243772 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1028019648 7:85754141-85754163 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1028081988 7:86588792-86588814 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1028327300 7:89542950-89542972 CAGCTAAAACAGTATTTAGAGGG + Intergenic
1028452739 7:91004000-91004022 GAGCTAAAGCAGTGCTTAGAGGG + Intronic
1028476174 7:91255871-91255893 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1028523277 7:91755426-91755448 CAGCTAAAACAGTGTTAAGAGGG + Intronic
1028915749 7:96257055-96257077 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1028998209 7:97125377-97125399 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1029844916 7:103403025-103403047 CAGCTAAAACAGTGTTTAGAGGG - Intronic
1030140689 7:106301315-106301337 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1030159784 7:106495303-106495325 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1030245448 7:107380166-107380188 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1030258225 7:107535159-107535181 CAGCTAAATCAGTGTTTAGAGGG + Intronic
1030325504 7:108214751-108214773 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1030454611 7:109757952-109757974 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1030707190 7:112705558-112705580 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
1030710983 7:112748710-112748732 CTGCTAAACCAGAGCTGACAGGG + Intergenic
1030770837 7:113473104-113473126 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1030801624 7:113859256-113859278 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1031032349 7:116748465-116748487 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1031090995 7:117353923-117353945 CTTCTAAAGCAGTGCTTACAAGG + Intergenic
1031336490 7:120539456-120539478 CTGCCAGAACAGTGCTCACAAGG + Intronic
1031902367 7:127425599-127425621 CAGCTAAAACAGTGTTTAAAGGG - Intronic
1032295621 7:130635855-130635877 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1032659450 7:133967479-133967501 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1032920216 7:136536881-136536903 CAGCTAAAACAGTGTTAAGAGGG + Intergenic
1032922219 7:136562033-136562055 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1033787659 7:144753279-144753301 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1034365776 7:150545648-150545670 CAGCTAAAGCAGTGCTTAGGGGG + Intergenic
1035052645 7:156010001-156010023 CAGCTAAAGCAGTACTTAGAGGG - Intergenic
1035703823 8:1658982-1659004 CAGCTAACACAGTGTTTAGAGGG - Intronic
1035946926 8:3974320-3974342 CTACTCAAACAGTGCTTAAGGGG - Intronic
1037257989 8:16976987-16977009 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1037719944 8:21434333-21434355 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1038083023 8:24161686-24161708 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1038514439 8:28173754-28173776 CAGCAAAAACAGTGCTCAGAGGG - Intronic
1038783761 8:30591960-30591982 CAGCTATAGCAGTGCTTATAGGG - Intronic
1038829211 8:31038167-31038189 CTGCTAAAACTGTTTTTCCATGG + Intronic
1039348662 8:36736086-36736108 CAGCTAAAGCAGTGCTGAGAGGG - Intergenic
1039654616 8:39388864-39388886 CAGCTAAAACAGTTCTGAGAGGG - Intergenic
1039754503 8:40509218-40509240 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1039802056 8:40966819-40966841 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1039808206 8:41021449-41021471 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1040031039 8:42823924-42823946 CAGCTAAAGCAGTGCTTTGAGGG - Intergenic
1040043156 8:42937541-42937563 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1040076206 8:43234052-43234074 AAGCTAAAGCAATGCTTACAGGG + Intergenic
1040344899 8:46482573-46482595 CTACAAAAACAGTGTTTCCAAGG + Intergenic
1040519805 8:48166511-48166533 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1040544639 8:48388750-48388772 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1040587854 8:48760996-48761018 TAGCTAAAACAGTGCTGAGAAGG - Intergenic
1040753174 8:50736902-50736924 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1040947027 8:52894718-52894740 CTGGTAAATCAGCCCTTACAGGG + Intergenic
1040960059 8:53022093-53022115 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1041323009 8:56634184-56634206 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1041418793 8:57644115-57644137 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1041459393 8:58095390-58095412 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1041658362 8:60376567-60376589 CTGTTAAAACAATGCATCCAGGG - Intergenic
1042288841 8:67145909-67145931 CAGCTAAAACAGTACTCAGAGGG - Intronic
1042326832 8:67537837-67537859 CCGCTAAAGCAGTGTTTAGAGGG - Intronic
1042622434 8:70721453-70721475 CAGCTAAAACAGTGTTTGGAGGG - Intronic
1042812615 8:72843087-72843109 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1042969031 8:74388330-74388352 CAGCTAAAGCAGTGTTTAGAAGG - Intronic
1043118091 8:76285730-76285752 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1043366039 8:79534614-79534636 CAGCTAAAACAATGCTTAGAGGG - Intergenic
1043381873 8:79711031-79711053 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1043532659 8:81167886-81167908 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1043563510 8:81522373-81522395 CTGCTTCAACAGTGCTTGGACGG - Intergenic
1043703865 8:83324558-83324580 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1043786354 8:84405204-84405226 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1044022349 8:87120708-87120730 CAGCAAAAACAGTGCTAACAGGG - Intronic
1044048179 8:87464243-87464265 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1044177292 8:89143265-89143287 CAGCTAAAGTAGTGCTTAGAAGG - Intergenic
1044377850 8:91497513-91497535 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1044395795 8:91709996-91710018 CAGCTACAGCAGTGCTTAGAGGG + Intergenic
1044509174 8:93055618-93055640 CAGCTAAAACAGTTTTTACTGGG - Intergenic
1044594936 8:93950119-93950141 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1044916991 8:97124767-97124789 AAGCTAAAGCAGTGCTTAGATGG + Intronic
1044961289 8:97533163-97533185 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1045151499 8:99413582-99413604 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1045184878 8:99827734-99827756 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1045793623 8:106016860-106016882 CTGCTAATACAGTACTTAAATGG + Intergenic
1045839627 8:106563978-106564000 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1045865884 8:106864815-106864837 TTGCTAAAACACTGCTTAGTAGG - Intergenic
1045877809 8:107002720-107002742 CTGCTAAAGCAGTGGTAAGAGGG + Intergenic
1045973667 8:108107140-108107162 CAGCTAAAACAGTGTTTAGATGG + Intergenic
1045975287 8:108124384-108124406 CAGCTAAAACAGTGTTTAGATGG + Intergenic
1046014900 8:108593046-108593068 CAGCTAAATCAGTGTTTAGAGGG + Intergenic
1046047689 8:108983762-108983784 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1046067689 8:109216163-109216185 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1046135056 8:110015185-110015207 CAGCAAAAGCAGTGCCTACAGGG - Intergenic
1046331016 8:112714914-112714936 CAGCTAAAGCAGTGTTTAGATGG + Intronic
1046862468 8:119109321-119109343 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1046972238 8:120235768-120235790 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1047030360 8:120872001-120872023 TAGCTAAGACAGTGCTTAGAGGG - Intergenic
1047098811 8:121654254-121654276 TAGCTAAAACAGTGCTGAGAGGG - Intergenic
1047133959 8:122054346-122054368 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1047369284 8:124242717-124242739 CAGCTAAAAAAGTGTTTAGAGGG - Intergenic
1048945023 8:139437776-139437798 CAGCTAAAGCAGTGCTTGGAGGG + Intergenic
1049136429 8:140905145-140905167 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1049382095 8:142321334-142321356 CAGCTAAAACAGTACTTACAAGG + Intronic
1049871798 8:144985190-144985212 CAGCTAAATCTGTGCTTAGAAGG + Intergenic
1050141280 9:2518734-2518756 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1050205723 9:3194419-3194441 CTCCTAAATCAGTGCCTCCAGGG + Intergenic
1050224676 9:3439164-3439186 CCACTAAAACAGTACTTATAGGG + Intronic
1050234088 9:3560013-3560035 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1050239611 9:3621485-3621507 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1050300201 9:4250763-4250785 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1050761765 9:9081146-9081168 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1051045466 9:12867968-12867990 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1051196754 9:14570328-14570350 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1051230754 9:14952691-14952713 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1051289149 9:15527832-15527854 CTGCTTCAACAGTGCTTGGATGG - Intergenic
1051338263 9:16086882-16086904 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1051447743 9:17158988-17159010 CAGCTAAAGCAGTGCTAAGATGG - Intronic
1051549008 9:18308183-18308205 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1051678384 9:19581494-19581516 CAGCTAAAACAGTCCTTGGAAGG + Intronic
1051836459 9:21343587-21343609 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1051962628 9:22786894-22786916 CAGCTAAAGGAGTGCTTAGAGGG - Intergenic
1052061259 9:23963848-23963870 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1052143753 9:25022705-25022727 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1052154591 9:25169083-25169105 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1052241664 9:26280403-26280425 TGGCTAAAGCAGTGCTTAAAGGG + Intergenic
1052336056 9:27321461-27321483 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1052583233 9:30389300-30389322 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1052767215 9:32653383-32653405 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1054719479 9:68590334-68590356 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1054782751 9:69180762-69180784 CTGCTAAAACTGAGCTCACCAGG - Intronic
1054952109 9:70863999-70864021 GTGCTAACAAAGTGCTTAAATGG + Intronic
1055210591 9:73786026-73786048 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
1055225817 9:73993716-73993738 CAACTAAAACAGTGCTTAGAAGG - Intergenic
1055288432 9:74756502-74756524 GAGCTAAAACAGTGGTTAGAGGG + Intronic
1055390665 9:75818892-75818914 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
1055906357 9:81298410-81298432 CAGCAAAAGCAGTGCTTAGAGGG + Intergenic
1056003242 9:82240156-82240178 CAGCTAAATCAGTGCTTAGAGGG - Intergenic
1056037605 9:82624065-82624087 CAGCCAAATCAGTGCTTAGAAGG + Intergenic
1056207082 9:84329919-84329941 TCGCTAAAGCAGTGCTTACAGGG + Intronic
1056302350 9:85255299-85255321 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1056321195 9:85436390-85436412 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1056477751 9:86969261-86969283 CTGCTGAAAAACAGCTTACAAGG - Intergenic
1056517387 9:87367603-87367625 CAGCTAAAGCAGTACTTAGAGGG - Intergenic
1056947145 9:91007596-91007618 CAGCTAACACGGTGCTTAGAGGG + Intergenic
1056970994 9:91203094-91203116 CTGCTAAAGCAGTGCTTAGAGGG + Intergenic
1057144726 9:92750042-92750064 TTTCTAAAACAGTGCTAATAAGG - Intronic
1058029550 9:100180129-100180151 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1058034293 9:100234516-100234538 CAGCTAAAGCAGTGGTTAGAGGG - Intronic
1058260092 9:102817349-102817371 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1058548703 9:106089450-106089472 CAGCTAAAGCAGTGGTTAGAGGG - Intergenic
1058582646 9:106475439-106475461 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1058831486 9:108821626-108821648 CAGCTAAATCACTGTTTACAGGG + Intergenic
1059090641 9:111354253-111354275 CAGCTAAAGCAGTGCTTAGAGGG - Intergenic
1059189959 9:112315954-112315976 GTGCTAAAGCCGTGCTTACAGGG + Intronic
1059317265 9:113436679-113436701 CAGCTAAAACAGTACATAGAGGG - Intergenic
1059630927 9:116121315-116121337 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1059951940 9:119474793-119474815 CAGCTAAAGCAATGCTTAGAGGG + Intergenic
1059954874 9:119505162-119505184 CAGCTAAAGCAGTGTGTACAGGG + Intronic
1060833551 9:126736935-126736957 TAGCTAAAACAGTGCTAAGAGGG + Intergenic
1060837737 9:126769601-126769623 CAGCTAAAACATTGCCTAGAGGG + Intergenic
1062019705 9:134313218-134313240 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1062079634 9:134617005-134617027 CTGCTAAAACAGTGATTTTAGGG - Intergenic
1062298009 9:135844441-135844463 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1185793748 X:2947501-2947523 AAGCTAAAACACTGCTTTCAAGG - Intronic
1186919725 X:14264899-14264921 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1186929410 X:14372071-14372093 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1187059116 X:15768964-15768986 CAGCTAAAGCAGTGCTTAGAGGG + Intronic
1187238632 X:17492285-17492307 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1187612699 X:20959834-20959856 CAGCTAGTACAGTGCTTAGAGGG + Intergenic
1187652774 X:21427700-21427722 ATGCTCAAACAGTGCTATCACGG + Intronic
1187653440 X:21439347-21439369 CAGCTAAAGCAGTGCTGAAAAGG + Intronic
1188107005 X:26158299-26158321 CTGTTGAACCAGTGCTTATATGG + Intergenic
1188296655 X:28458172-28458194 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1188351389 X:29135599-29135621 AGGCTAACATAGTGCTTACAGGG - Intronic
1188599941 X:31950145-31950167 TAACTAAAGCAGTGCTTACAGGG - Intronic
1188892991 X:35633557-35633579 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1189023514 X:37367265-37367287 CAGTTAAAATAGTGCTTAGAAGG - Intronic
1189050876 X:37644299-37644321 CTGCTAAAACACAGCTTCCCAGG - Intronic
1189082028 X:37983979-37984001 CAGCTAAAGCAGTGGTTAGAGGG + Intronic
1189189959 X:39092152-39092174 CACCTAAAACAGTGTTTAGAGGG + Intergenic
1189873297 X:45406686-45406708 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
1189898011 X:45675942-45675964 CAGCTAAAGCAGTGCTAAGAGGG + Intergenic
1189958343 X:46300068-46300090 CTGATAAAATAGTCCTTAGAGGG + Intergenic
1190341094 X:49296669-49296691 CAGCTAAAGCAGTGTTTAGAAGG - Intronic
1190402586 X:50053657-50053679 CAGCAAAATCAGTGCTTAGAGGG - Intronic
1190420097 X:50221425-50221447 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1190494159 X:51012020-51012042 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1190540488 X:51472894-51472916 CAGCTAAAGCAGTACTTACTGGG - Intergenic
1190572836 X:51802042-51802064 CAGCTAAAGCAGTGCTTAGTGGG + Intergenic
1190584947 X:51930470-51930492 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1191027616 X:55931522-55931544 CAGCTAAAGCAGTGTTTAGATGG - Intergenic
1191159865 X:57318002-57318024 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1191168274 X:57415376-57415398 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1191181802 X:57572139-57572161 CGGCTAAAACAGTGTTTAGAGGG + Intergenic
1191588562 X:62855776-62855798 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1191591588 X:62891088-62891110 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1191632242 X:63334232-63334254 CAGCTAAAGCAGTGTTTACAGGG + Intergenic
1191708873 X:64126338-64126360 CAGCTAAAGCAGTGCTCAGAGGG - Intergenic
1191774655 X:64800734-64800756 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1191802937 X:65101235-65101257 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1192078113 X:68020626-68020648 CAGCTAAAACAGTGTTAAAAGGG + Intergenic
1192103007 X:68285369-68285391 CTGCTAAAACAGTGTTTGGAAGG - Intronic
1192286120 X:69738639-69738661 CAACTAAAATAGTGCTTAAAGGG - Intronic
1192353526 X:70378152-70378174 CAGCTAAAACAGTGTTTGGAGGG + Intronic
1192540560 X:71967437-71967459 CAGCAAAAGCAGTGCTTAGAAGG - Intergenic
1192595435 X:72402505-72402527 CAGCTAAAGCAGTGCTCAGAAGG - Intronic
1192596702 X:72416686-72416708 CACCTAAAACAGTGCTGAGAGGG - Intronic
1192598844 X:72440314-72440336 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1192622469 X:72692982-72693004 CAGAGAAAACAGTGCTTAGAGGG - Intronic
1192662397 X:73055349-73055371 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1192663433 X:73066682-73066704 CAGCTAAAGCAGTTCTTAGAGGG + Intergenic
1192741305 X:73895498-73895520 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1192774450 X:74227615-74227637 CAGCAAAAACAGTGCTTATAGGG + Intergenic
1192883305 X:75310990-75311012 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1192887556 X:75351586-75351608 CAGCTAAAGCAGGGCTTAGAGGG - Intergenic
1192932085 X:75817167-75817189 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1193071986 X:77315589-77315611 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1193171642 X:78344132-78344154 CAGCTAAAGCAGTGTTTAGAAGG + Intergenic
1193195723 X:78629444-78629466 CAGCTAAAACAGTGTTTACTGGG - Intergenic
1193217557 X:78882285-78882307 CAGTTAAAACAGTGTTTACAGGG - Intergenic
1193309828 X:79992762-79992784 CAGCAAAAACAGTGCTAAGAGGG + Intergenic
1193327032 X:80190436-80190458 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1193361428 X:80584035-80584057 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1193510297 X:82391068-82391090 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1193525016 X:82578466-82578488 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1193615731 X:83686058-83686080 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1193633669 X:83922091-83922113 CACCAAAAACAGTGCTAACAGGG - Intergenic
1193646942 X:84080967-84080989 CAGCTAAAGCAGTGTTTACAGGG + Intronic
1193755599 X:85405498-85405520 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1193769040 X:85566798-85566820 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1193782154 X:85716808-85716830 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1194016495 X:88627648-88627670 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1194025965 X:88751221-88751243 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1194140201 X:90199246-90199268 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1194203823 X:90986495-90986517 CTGGTAATGCAGTGTTTACAAGG + Intergenic
1194230839 X:91321564-91321586 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1194357187 X:92900306-92900328 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1194625056 X:96217507-96217529 CAGCTAAAGCAGTGTTTAAAGGG + Intergenic
1194782855 X:98046505-98046527 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1194837193 X:98696252-98696274 CAGCTAAAACAGTGTGTAGAGGG - Intergenic
1195248502 X:103019402-103019424 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1195518867 X:105808672-105808694 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
1195631839 X:107064293-107064315 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1195744403 X:108101534-108101556 CAGCTAAAGCAGTGCTGAGATGG - Intronic
1195882432 X:109606389-109606411 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1195948497 X:110241070-110241092 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1195955540 X:110325915-110325937 CAGCTAAAGAAGTGCTTAGAGGG - Intronic
1195985865 X:110629303-110629325 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1196019829 X:110979767-110979789 CTGCTAAAGCAGTGCTGAGAGGG - Intronic
1196262532 X:113600505-113600527 CAGCAAAAACAGTACTAACAAGG + Intergenic
1196272882 X:113733146-113733168 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1196570050 X:117255430-117255452 CAGCTAAAGCAGTGTTTAAAGGG - Intergenic
1196946299 X:120830214-120830236 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1197046199 X:122001501-122001523 CTGCTAAAGCATTGTTAACAGGG - Intergenic
1197157528 X:123286258-123286280 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1197327667 X:125114251-125114273 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1197601830 X:128540440-128540462 CAGCTGAAACAGTGTTTAGAGGG - Intergenic
1197614010 X:128672166-128672188 CAGCTAAAGCAGTGTTTACAGGG - Intergenic
1197684332 X:129422771-129422793 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1197684594 X:129426278-129426300 CAGCAAAAGCAGTGCTAACAAGG - Intergenic
1197880482 X:131161557-131161579 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1198001972 X:132448791-132448813 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1198042607 X:132868770-132868792 CAGCTAAAGCAGTGTTTAGAAGG + Intronic
1198060284 X:133039315-133039337 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1198295110 X:135279638-135279660 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1198433691 X:136593255-136593277 CAGCTAAAACAGTGCCAAGAAGG - Intergenic
1198477077 X:137005496-137005518 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1198490232 X:137132442-137132464 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic
1198519291 X:137436288-137436310 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1198678925 X:139160330-139160352 CAGCTAAAGCAGTGTTTAGAGGG + Intronic
1198758270 X:140003437-140003459 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1198924570 X:141773306-141773328 ATATTAAAACTGTGCTTACAGGG - Intergenic
1198956976 X:142143899-142143921 TAGCTAAACCAGTGCTTACAGGG + Intergenic
1199007582 X:142720241-142720263 CAGCTAAATCAGTGTTTAGAGGG + Intergenic
1199011764 X:142767002-142767024 CAGCTAAAACAGTGTTCAGAGGG - Intergenic
1199016513 X:142822044-142822066 CAGCTAAAACAGTGTTAAGAGGG - Intergenic
1199095047 X:143728161-143728183 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1199324339 X:146478981-146479003 CTGCTAAAGCACTGTTTAAAGGG - Intergenic
1199436894 X:147822388-147822410 CAGCTAAAGCAGTGTTTAGAGGG + Intergenic
1199524634 X:148778994-148779016 CAGCTAAAGCAGTGTTTAGAGGG - Intronic
1199683980 X:150249168-150249190 CTCCAAAAGCAGTGCTTAGAGGG + Intergenic
1200095825 X:153661181-153661203 CAGCTAAAGCAGTACTTAGAAGG + Intergenic
1200426270 Y:3023776-3023798 GTGCTGAAACAGTTGTTACAGGG + Intergenic
1200549658 Y:4561944-4561966 CTGGTAATGCAGTGTTTACAAGG + Intergenic
1200665519 Y:6017306-6017328 CAGCTAAAGCAGTGTTTAGAGGG - Intergenic
1201374763 Y:13306889-13306911 CTCATAAAACAGTGTCTACAGGG - Intronic
1201978646 Y:19882144-19882166 CTGCAAAAACAGAGCTCACTTGG - Intergenic
1202043236 Y:20709395-20709417 CAGCTAAAGCAGTGCTTAGAGGG + Intergenic