ID: 918034236

View in Genome Browser
Species Human (GRCh38)
Location 1:180851352-180851374
Sequence GGGTGTGGTGGAGGAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 933}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918034226_918034236 21 Left 918034226 1:180851308-180851330 CCATTTACAAATGGACACAAAAT 0: 1
1: 1
2: 2
3: 59
4: 598
Right 918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG 0: 1
1: 0
2: 6
3: 69
4: 933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918034236 Original CRISPR GGGTGTGGTGGAGGAGTAGA GGG Intronic
900243022 1:1625807-1625829 GGGTGGGGTCAAGGAGAAGAGGG + Intronic
900323180 1:2095031-2095053 GGGTGTGGCGGAGCAGCACATGG - Intronic
900463752 1:2813654-2813676 GGGTGTGGTGCAGGACTGGTGGG + Intergenic
900649832 1:3725400-3725422 GGGTGGGGTGGATGAATGGATGG + Intronic
900659173 1:3774337-3774359 GGGTGTGGGGGTGGAGGAGTTGG - Intronic
900768486 1:4521132-4521154 CTGTGTGGTGGAGGTGGAGATGG - Intergenic
900885612 1:5413333-5413355 GGGTTTGCTGCAGGAATAGAGGG - Intergenic
900975298 1:6012644-6012666 GGTTGTGGTGGAGGTGATGAAGG + Intronic
901380095 1:8867340-8867362 AGGTGTGATGGGGGAGGAGATGG - Intronic
901786118 1:11626056-11626078 GGATGTGGTGGAGGAGATGGTGG + Intergenic
901835423 1:11921052-11921074 GGGAGGGGAGGAAGAGTAGAGGG + Intronic
901908376 1:12433964-12433986 GTGTGTGGAGGAGGAGGAGGAGG + Intronic
902039804 1:13484337-13484359 GGGAGTGGGGGAGGAGCAGGGGG - Intronic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902385336 1:16072869-16072891 GGGTGGGGAGGAGGATTAGGGGG + Intronic
902517024 1:16995048-16995070 GGGAGTGGTGGAGCAGGACAGGG - Intronic
903385665 1:22924563-22924585 GGGTTTGGTGGAGGAGTGGAGGG - Intergenic
903533777 1:24052942-24052964 AGGTGTGGAGGAGGAGTGGCTGG + Intergenic
903577069 1:24345630-24345652 GGGTGTGTTGGGGAAGGAGATGG - Intronic
903646545 1:24899451-24899473 GGGTGGGGTGGGGGAGAGGATGG - Intergenic
904037480 1:27566675-27566697 GGGGGTGGAGGAGGAGGAGGAGG + Intronic
904400457 1:30253481-30253503 GAGTGTGGTCAAGGAGAAGAAGG + Intergenic
904457008 1:30653852-30653874 GGGTGTGGGGGAGGAGGTGAAGG + Intergenic
904626662 1:31809930-31809952 TGGAGTGTTGCAGGAGTAGAGGG - Intronic
905520220 1:38593275-38593297 GGGTGTCATGGAGAAGTAGTGGG - Intergenic
906326471 1:44849260-44849282 AAGTGCGGTGGAGGAGTAAAGGG - Intergenic
906952767 1:50348212-50348234 GGGTGTGGTAGAGGAATAGGTGG - Intergenic
907159775 1:52361545-52361567 GGATGTGGAGGAGGAGGAGGAGG - Exonic
907692108 1:56679439-56679461 GGGTGTGGTGGGAGAGTGGAGGG + Intronic
907692512 1:56683610-56683632 GTGTGTGGTGGAGGGGTGGTGGG + Intronic
908035390 1:60046208-60046230 GGGGGAGGAGGAGGAGGAGAAGG - Intronic
908152434 1:61316225-61316247 GGGTAAGGGTGAGGAGTAGAGGG + Intronic
908696102 1:66843219-66843241 GGGTGGGGGGGAGGAGGAGGAGG + Intronic
909206134 1:72760017-72760039 GGGTGTGGATGTGGAGTAAAAGG - Intergenic
909531190 1:76683610-76683632 TGGTGTGTTGGAGGAGGAGCAGG + Intergenic
909643274 1:77889302-77889324 GGGTGTGGGGGGGGAGTAATAGG - Intronic
910172313 1:84390670-84390692 GGATGAGGTGGAGGGGTATAAGG + Intergenic
910286109 1:85556104-85556126 GGGTGAGGAGGAGGAGGAGAAGG - Intronic
910484472 1:87697673-87697695 GGCTGAGGAGGAGGAATAGAAGG - Intergenic
910860940 1:91741856-91741878 CAGTGTGGAGGAGGGGTAGAAGG - Intronic
910875749 1:91876099-91876121 GGGTGTGGTGGGGGTGTGGTGGG + Intronic
911091990 1:94024579-94024601 GAGGGAGGTGGAGGAGTATAGGG - Intronic
912564388 1:110575869-110575891 TTGTGTTGTGGAGGAGGAGAGGG - Intergenic
912660597 1:111526173-111526195 GTGTGTGGTGGGGAGGTAGAGGG - Intronic
913320406 1:117584136-117584158 GGCTGAGGAGGAGGAGGAGAAGG + Intergenic
913558031 1:119988739-119988761 AGGTCTGGTGGTGTAGTAGAAGG + Intronic
913593848 1:120354692-120354714 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
913645625 1:120851246-120851268 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
913653754 1:120942305-120942327 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914081087 1:144412280-144412302 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914093407 1:144524294-144524316 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914096278 1:144546810-144546832 GGGTGGGGCGGAAGAGCAGAAGG - Intergenic
914096956 1:144552196-144552218 GGTTGGGGTGGAAGAGCAGACGG - Intergenic
914176002 1:145280814-145280836 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914242223 1:145859560-145859582 GTGTATGGGGGAGGAGGAGAGGG - Intronic
914302238 1:146387153-146387175 GGGTGGGGCGGAAGAGCAGAAGG + Intergenic
914305121 1:146409608-146409630 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914519446 1:148402435-148402457 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914596937 1:149163217-149163239 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914643946 1:149636471-149636493 GGGTGAGGCGGAAGAGCAGACGG + Intergenic
914797235 1:150930676-150930698 GGGTGTGGTGGTGGGGCAGGGGG - Intronic
914900554 1:151709085-151709107 GGTTGAGATGGAGGAGGAGAGGG + Intronic
915121376 1:153631611-153631633 GGGGGTGGTTGAGGAGCAGGAGG - Intronic
915341258 1:155178055-155178077 GGCTGTGCTGGAGGAGAAGCGGG + Exonic
915495491 1:156279749-156279771 GGGTATGATGGGGAAGTAGAGGG + Intronic
915545239 1:156593387-156593409 GGCTGTGGTGGAGCAGGAAAAGG - Exonic
915609030 1:156976108-156976130 GTGTGTGTTGGAGCAGTAGATGG - Intronic
915761857 1:158321911-158321933 GAGTGTGGTGGATGAGAGGAGGG - Intergenic
915898722 1:159831041-159831063 GGCTGTGGTGGAGGTGGAGGTGG - Intronic
915935464 1:160087884-160087906 GGAGGTGGTGGAGGAGGAGGAGG + Exonic
915983514 1:160439226-160439248 GGGAGAGGTGGAAGAGTAGCTGG + Intergenic
916609182 1:166373660-166373682 TGGTGTGGTGGAGGAGGGGGAGG - Intergenic
916742089 1:167655050-167655072 GGCTGTGGAGGAAGAGTACAAGG + Intronic
917003520 1:170386495-170386517 GAGTGAGATGGTGGAGTAGAAGG - Intergenic
917294236 1:173502427-173502449 GGGTGGACTGGAGGAGCAGATGG - Intronic
917598360 1:176552308-176552330 GGGAGAGATGGAGGAGGAGAGGG - Intronic
917808330 1:178634366-178634388 GGGTGGGGAGGGGAAGTAGAGGG - Intergenic
917969958 1:180199977-180199999 GGGTGTGGGGGTGGAGGAGAGGG + Exonic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918366911 1:183817758-183817780 GTGTGTGGTGGTAGAGGAGAAGG + Intronic
918659949 1:187075210-187075232 AGGTGTGGTCATGGAGTAGAAGG - Intergenic
918799433 1:188953584-188953606 GGGTGTGCTGGAGGAGCCAAAGG - Intergenic
919091661 1:192984854-192984876 GGGTGTGGGGAGGGAGTAGAGGG - Intergenic
919334493 1:196214595-196214617 AGGTGTGGTAAAGGAGAAGAGGG + Intergenic
919416796 1:197320557-197320579 GAATGTGGTACAGGAGTAGATGG + Intronic
919829574 1:201531098-201531120 GGGTGGGCTGGATGAGTGGAGGG + Intergenic
920079158 1:203359745-203359767 GTGTGGGGTGTAGGATTAGAAGG + Intergenic
920848757 1:209614485-209614507 GGGTGGGGTGGAGGATGATATGG - Intergenic
921007906 1:211112292-211112314 GGGAGGGGTGGAGGGGTGGAGGG - Intronic
921335948 1:214086514-214086536 GGTTGTGGTGGAGGATGAGAAGG - Intergenic
921364537 1:214361316-214361338 GGATGTGGTGGTGGAGGAGGTGG - Intronic
921492748 1:215798930-215798952 GAGTGTTGTGGTGGAGAAGAAGG - Exonic
921543769 1:216450294-216450316 GGGTGGGGTGGAAGAAGAGAAGG - Intergenic
922427669 1:225514711-225514733 GGAGGTGGTGGAGGAGGAGGGGG + Exonic
922427722 1:225514855-225514877 GGGAGTGGTGGAGGAGGTGGAGG + Exonic
922433446 1:225580071-225580093 GGGTGTGGGGAAGAAGAAGAAGG - Intronic
922618755 1:226978220-226978242 GTGTGTGGTGGGTGTGTAGAGGG - Intronic
923052782 1:230400326-230400348 GAGTGTGGGGGAGGGGTGGAAGG - Intronic
923146461 1:231202112-231202134 GGTAATGGTGGAGGAGGAGATGG + Intronic
923857594 1:237861773-237861795 GGGAGAGGAGGAGGAGTATATGG + Intergenic
924003732 1:239583637-239583659 GGGTGTGGGGAAGGAGAAAAGGG - Intronic
924384807 1:243490822-243490844 GGGTCTGGTGGAGGATGAGGGGG - Intronic
924907085 1:248467272-248467294 GGGGGTGGTGAAGGGGTAGGTGG - Intergenic
1063152683 10:3351065-3351087 GGGTTGGGGGGAGGAGAAGAGGG - Intergenic
1063233777 10:4091131-4091153 GGAAGCAGTGGAGGAGTAGAGGG - Intergenic
1064287349 10:14003320-14003342 GGGGGTGTTGGAGGAGAAGCAGG + Intronic
1064765954 10:18671637-18671659 GGGGGAGGAGGAGGAGGAGATGG - Intronic
1064765955 10:18671643-18671665 GGGTGAGGGGGAGGAGGAGGAGG - Intronic
1064782110 10:18853395-18853417 GGGTGTGGTGGAGGACTTGAAGG + Intergenic
1064980166 10:21158568-21158590 GGATGTGGTGGGGGAGTGAAGGG - Intronic
1065043085 10:21717502-21717524 GGAGGTGGTGGAGGAGGAGGAGG - Intronic
1065257289 10:23883769-23883791 GGGAGAGATGGAGGAATAGATGG - Intronic
1065663842 10:28037230-28037252 TGGTGTTTTGGAGGAGTAGGTGG - Intergenic
1066287187 10:33979773-33979795 GGGTGTGGGGGGAGAGGAGAAGG - Intergenic
1066394805 10:35009104-35009126 GGGTGTGGTGGTGGTGGTGATGG + Exonic
1067089885 10:43261207-43261229 GGGAGTGGTGGTGGTGGAGAGGG - Intronic
1067554324 10:47257528-47257550 GGGGGTGGTGGTGGAGGAGCAGG + Intergenic
1067554325 10:47257531-47257553 GGTGGTGGTGGAGGAGCAGGTGG + Intergenic
1067831251 10:49612344-49612366 GGGTGGGCTGGAGGAGGAGTGGG - Exonic
1068409145 10:56632524-56632546 GTGAGTGGTGTGGGAGTAGAAGG - Intergenic
1068510057 10:57954406-57954428 GGCTGAGGAGGAGGAGAAGAAGG - Intergenic
1068658563 10:59599717-59599739 GGGTGGGGTGGAGGGGTTGGAGG + Intergenic
1069047607 10:63759589-63759611 AGGGGTGGTGGAGGAGGGGAAGG + Intergenic
1069077648 10:64054982-64055004 GGGGGGGGTGGGGGAGTGGAAGG - Intergenic
1069822638 10:71237003-71237025 GGAGGAGGTGGAGGTGTAGATGG + Intronic
1069921733 10:71819682-71819704 GGGTGTGGTGCGGGAGAGGATGG - Intronic
1070466206 10:76726383-76726405 GGGTGTTGTGGAGGTGTGGTGGG - Intergenic
1071503940 10:86221901-86221923 GGGTGAGGAGGAGGAGGAGGAGG - Intronic
1071949093 10:90682682-90682704 ATATGGGGTGGAGGAGTAGAAGG - Intergenic
1072036706 10:91569522-91569544 GGGTGTGGGGCAGGAGAATAGGG - Intergenic
1072102546 10:92243084-92243106 GTGTGTGGTGGGGGAGGGGAAGG - Intronic
1072443166 10:95475205-95475227 GGGGGTGGTGGTGCAGAAGAGGG + Intronic
1072820529 10:98552064-98552086 GGATGTGGTGGATGAGGAGAGGG + Intronic
1073094076 10:100969465-100969487 GGGGGTGGTGGAGGCGGAGCCGG - Intronic
1075575201 10:123572761-123572783 GGGAGGGGAGGAGGAGGAGAGGG + Intergenic
1076988370 11:256104-256126 GGGTGGGTGGGAGGAGTGGATGG + Intergenic
1077174237 11:1181430-1181452 GGGTGTGGAGAAGGAGAAGGTGG - Intronic
1077363051 11:2149311-2149333 GGTTGACGTGGAGGAGGAGAGGG + Exonic
1077865508 11:6218298-6218320 GGGGGTGGTGGATGAGGATAAGG - Intronic
1077896589 11:6457733-6457755 GGATGTGGTGGAGCAGCACAAGG - Exonic
1078050112 11:7957619-7957641 GGGGGTGGTGGTGGTGGAGAGGG - Intergenic
1078098150 11:8313029-8313051 GGGTGGGGTGGAGCAGGTGAGGG - Intergenic
1078105600 11:8356349-8356371 GGCTGTGGAGGGGGAGAAGAAGG + Intergenic
1078604390 11:12762238-12762260 GGGTATGGTGGAGAGGAAGAAGG + Intronic
1078665417 11:13320887-13320909 GGGTGGGGTGGAAAAGTAGGTGG + Intronic
1079703931 11:23589034-23589056 GGAGGAGGTGGAGGAGGAGAAGG + Intergenic
1080197776 11:29632100-29632122 GGGCATGGTGGAGGAGGTGAAGG - Intergenic
1080389100 11:31827340-31827362 GGGTGGGGAGGAGGAGCAGGAGG - Intronic
1081310854 11:41570064-41570086 GCGTGTGCTGGTGGAGTGGAGGG + Intergenic
1081719087 11:45273458-45273480 GGGTGTGGAGGGGGAGAAAATGG + Intronic
1082045531 11:47723028-47723050 GGTGGTGGTGGAGGAGGAGGAGG + Exonic
1082790379 11:57342814-57342836 GTGTGTGTGGGAGGAGGAGAGGG - Intronic
1083573380 11:63771882-63771904 GAGTGAGGAGGAGGAGGAGAAGG + Intergenic
1083750018 11:64755746-64755768 GGGTGTCGGGGAGGTGTTGAGGG - Intronic
1084466296 11:69324927-69324949 TGATGTGGTGGTGGAGTTGATGG + Intronic
1084694661 11:70746328-70746350 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1084694692 11:70746427-70746449 GAGTGTGGTGGGAGAGGAGATGG - Intronic
1085362484 11:75903073-75903095 AGGTGGGGAGGAGGAGGAGAAGG - Intronic
1085428724 11:76427824-76427846 GGGGGTGGTGGAGTAGGTGAAGG + Intergenic
1086954584 11:92922986-92923008 GGGTGTGGTGGAGCAGGGTATGG + Intergenic
1088822028 11:113464568-113464590 GGGTGTGCTTGGGGAGTAGGAGG - Intronic
1088828845 11:113518069-113518091 GTGTTTGGTGGAGGAGTTGAAGG + Intergenic
1088898165 11:114093410-114093432 GAGTGTAGTGGAGGAAGAGAGGG - Intronic
1089004766 11:115082205-115082227 GGGTTTGCTGGATGAGTGGATGG + Intergenic
1089074307 11:115725895-115725917 GGTTGTGGTGGTGGTGGAGATGG - Intergenic
1089139436 11:116274307-116274329 GCGTGTGGGGGAGAAGCAGAGGG - Intergenic
1089305326 11:117522785-117522807 GGGCTTCGTGGAGGAGTAGGGGG + Intronic
1089351738 11:117825201-117825223 GGATGTGGTGGGGGAGCAGTGGG - Intronic
1089852783 11:121514870-121514892 AGGGGTGGTGGAGGAGTTGGGGG + Intronic
1090893979 11:130952814-130952836 GGGCATGGTGGGTGAGTAGAGGG + Intergenic
1091124348 11:133082382-133082404 GGGTGCGGGGGAGGGGAAGAGGG - Intronic
1091282830 11:134391637-134391659 TGGGGTGCTGGAGGAGGAGATGG + Exonic
1091562407 12:1625080-1625102 GGGTTTGTTCTAGGAGTAGAAGG + Intronic
1091591476 12:1845383-1845405 GGGTGGGGGGGAGGAGGGGAGGG + Intronic
1092079563 12:5704127-5704149 GGGTGTGGGGGTGGGGAAGAGGG + Intronic
1092160290 12:6312044-6312066 GGGTATAGTGGGGGAGGAGAGGG - Intronic
1092167498 12:6351707-6351729 GGCAGTGGTGGAGGAGGGGAGGG + Intronic
1092632491 12:10397411-10397433 GGGTGTGGTGGGTGGGCAGAAGG - Intronic
1092884786 12:12915630-12915652 GGGCATGGTGGAGGAGGAGGAGG - Exonic
1092947342 12:13469007-13469029 GGGTGGGGTTGAGCAGCAGAGGG + Intergenic
1093140792 12:15508385-15508407 AGGTGAGGTCAAGGAGTAGAGGG + Intronic
1093946037 12:25110550-25110572 TGGTGTGCTGGAGGATTGGAGGG - Intronic
1095593725 12:43935971-43935993 GGGAGTGGTGAGGGAGGAGAGGG + Intronic
1095961074 12:47834757-47834779 GGAGGTGGTAGAGGAGTGGATGG - Intergenic
1095981203 12:47975711-47975733 GGGTGGGGCGGAGGTGTAGCAGG + Intronic
1096198312 12:49663373-49663395 GGGTGTGCAGGAGCAGCAGATGG - Intronic
1096541784 12:52312122-52312144 GGTAGTGGTGGTGGAGAAGATGG + Intergenic
1096710506 12:53452225-53452247 GGGGGTGGAGGAGGAGGAGGAGG - Exonic
1097035589 12:56121601-56121623 GGGGGTGGTGGAGCAGCAGGAGG - Exonic
1097199579 12:57266851-57266873 AGGAGTGGTGAAGCAGTAGAGGG + Intronic
1098588975 12:72187498-72187520 GGTGGTGGTGGAGGAGGAGGAGG + Intronic
1098621700 12:72608857-72608879 GGGTGTGGTGTAGGAGGACTGGG + Intronic
1098849080 12:75573197-75573219 GAGTGTGGTGGAAGATAAGATGG + Intergenic
1099063889 12:77949492-77949514 GGAAGTGGAGGAGGAGGAGAAGG - Intronic
1099950137 12:89292804-89292826 GGGTGTTGTGGAGCATTGGATGG + Intergenic
1100719016 12:97337250-97337272 GGGTGTGGAGTGGGGGTAGAGGG - Intergenic
1101082647 12:101204857-101204879 GGGTTTGGCGGGGGAGAAGAGGG - Intronic
1101440212 12:104698272-104698294 GGGTGAGGAGGTGGAGAAGATGG - Intronic
1101462083 12:104906362-104906384 GTGTTTGTTGGAGGTGTAGATGG + Intronic
1101559794 12:105845608-105845630 GGCTGAGGTGAAGGAGGAGAAGG - Intergenic
1101567311 12:105920324-105920346 GGTTGTGGTGGAGGAAGAAAGGG + Intergenic
1101831783 12:108263572-108263594 GGGTGTGTTGGATAAGTGGAGGG - Intergenic
1101835044 12:108289166-108289188 GGGTGGGGTGGGGGAGCTGAGGG - Exonic
1101862311 12:108493324-108493346 GGGTGTGGTGGCAAAGGAGAGGG - Intergenic
1102394250 12:112574209-112574231 GGGGGTGGTGGAGGAGTGAGGGG + Intronic
1102394275 12:112574290-112574312 GGAGGTGGTGGAGGAGTAAGAGG + Intronic
1102394425 12:112574765-112574787 GGGTGTGGTGGAGGAGGGAGGGG + Intronic
1102394510 12:112575004-112575026 GGGGGTGGTGGAGGTGGAGGAGG + Intronic
1102591995 12:113963380-113963402 GTGTGTGGTAGTGGAGTTGAGGG + Intronic
1102668693 12:114599036-114599058 CAGTGTGGTGGAGGAGTTCAGGG + Intergenic
1102697742 12:114813465-114813487 GGGGATGGTGGAGGAGAAGGGGG + Intergenic
1102710435 12:114921501-114921523 GAGGAGGGTGGAGGAGTAGAGGG - Intergenic
1103074121 12:117968646-117968668 GGGAGAGGAGGAGGAGGAGAAGG + Intronic
1103308981 12:119989603-119989625 GGGGGTAGTGGCGGAGTAGGTGG - Intergenic
1103324113 12:120109012-120109034 GGGTGGGCTGGTGGAGTGGAGGG + Intronic
1103948691 12:124540590-124540612 GGATGGGGTGGAGAACTAGAGGG + Intronic
1104001975 12:124865635-124865657 GGGTGTGGTGGAGGACTTCAGGG - Intronic
1104376658 12:128268982-128269004 GGGGGTGGAGGAGTAGGAGAGGG + Intronic
1104589919 12:130075908-130075930 GGGAATGGTGGAGGAGCAGAGGG + Intergenic
1104626274 12:130358207-130358229 GGGTGTGTGGGAGGTGCAGAGGG + Intronic
1104968367 12:132520080-132520102 GGGTGTGCTGGAGGGGTGCAAGG - Intronic
1104968381 12:132520128-132520150 GGGTGTGCTGGAGGGGTGCAAGG - Intronic
1104968394 12:132520174-132520196 GGGTGTGCTGGAGGGGTACAAGG - Intronic
1104968401 12:132520198-132520220 GGGTGTGCTGGAGGGGTGCAAGG - Intronic
1105705003 13:22963191-22963213 GGATGGTGAGGAGGAGTAGAAGG + Intergenic
1105857960 13:24388369-24388391 GGATGGTGAGGAGGAGTAGAAGG + Intergenic
1106209947 13:27632750-27632772 GTGTGTGTTTGAGGGGTAGAGGG - Intronic
1106624767 13:31409284-31409306 GGATGGGGTGGATGAGCAGAGGG + Intergenic
1106675464 13:31953259-31953281 GCGTGTGGTGGAGGACAAGGTGG + Intergenic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1107129459 13:36879642-36879664 GGGGCTGGTGAAGGAGAAGAGGG + Exonic
1107142904 13:37022278-37022300 GGGGTTGGTGTAGGAGTAGATGG + Exonic
1107255242 13:38418039-38418061 GGGGGAGGAGGAGGAGTATATGG + Intergenic
1107426150 13:40294962-40294984 GGGTGTGGTTGGGGAGAGGAGGG + Intergenic
1107897137 13:44976383-44976405 AGGTGAGGAGGAGGAGGAGAAGG + Intronic
1107960275 13:45551426-45551448 GGATGTGAAGGAGGAGTAGGAGG - Intronic
1109015788 13:57011478-57011500 GTGTGTGGTGGTGGTGGAGAGGG + Intergenic
1110247411 13:73342277-73342299 GGGTCTGGTGGAGCAGTATTTGG + Intergenic
1110355722 13:74564808-74564830 GGGTGGGGTAGAGGAGTCGGGGG - Intergenic
1112299902 13:98220289-98220311 GGAGGTGGTGGAGGAGGAGGAGG + Intronic
1112417485 13:99215824-99215846 CGGTGCGATGAAGGAGTAGATGG - Intronic
1112483313 13:99796858-99796880 GGGTGTGGTGACTGACTAGATGG - Intronic
1112832065 13:103465019-103465041 GGGGGTGGGGAAGGAGTGGATGG + Intergenic
1113403148 13:110013763-110013785 AGGTGTGGTGGAATAGAAGAGGG - Intergenic
1113530431 13:111020535-111020557 TGATGTGGTGGAGGAGCAGAGGG + Intergenic
1113566187 13:111320975-111320997 GGGTGGGGTGGGGGAGCAGTTGG + Intronic
1113792541 13:113036771-113036793 GGGTCTGGTGGAGGAGTTGGGGG - Intronic
1114318052 14:21525228-21525250 GGGGGTGGTGGAGGAGGAGGGGG + Exonic
1114483575 14:23049562-23049584 AGGGGTGGAGGAGGAGGAGAAGG + Intronic
1115024195 14:28721240-28721262 GGGAGGGGAGGAGGAATAGATGG + Intergenic
1115187938 14:30713312-30713334 GGGAGTGGTAGATGTGTAGATGG + Intronic
1117846776 14:59920072-59920094 GGGTGGGGAGGAGGAGAAAAGGG - Intronic
1118045676 14:61968331-61968353 GGGTGTGGTTGAGGAGCATGTGG + Intergenic
1118318153 14:64737969-64737991 GGAGGTGGTGGAGGAGGAGGAGG + Intronic
1118690441 14:68333923-68333945 GGGTGTGGTGGAGAGGGGGATGG - Intronic
1118773722 14:68960117-68960139 GGCTGAGGAGGAGGAGAAGAAGG + Intronic
1118907711 14:70034569-70034591 GGGTGGCGTAGAGGAATAGAAGG - Intergenic
1120045364 14:79799667-79799689 GGGTGGGCTGGAGAAGGAGAAGG - Intronic
1120217607 14:81696896-81696918 GTGTGTGGTGGAGGAGAGGGGGG + Intergenic
1120705435 14:87740459-87740481 GGGTGTGGGGGACGAGGGGACGG - Intergenic
1120874273 14:89362264-89362286 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
1120874301 14:89362357-89362379 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
1120874318 14:89362411-89362433 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
1120874332 14:89362459-89362481 GGTGGTGGTGGAGGAGGAGGTGG - Intronic
1121413675 14:93764270-93764292 GGGGGTGGGGGAGGGGAAGAAGG - Intronic
1121662699 14:95647227-95647249 TGCTGGAGTGGAGGAGTAGAAGG + Intergenic
1122254174 14:100464604-100464626 GGGTGTGGGAGATGAGGAGAGGG - Intronic
1122291920 14:100685571-100685593 GGCTGAGGTGGAGGGGTAGCAGG - Intergenic
1122419009 14:101563845-101563867 GGGTGAGGTGGAGGGCGAGAGGG + Intergenic
1122600769 14:102920618-102920640 GTGGGTGGTGGATGAGTGGATGG - Intergenic
1122611309 14:102985187-102985209 GGGTGGTGTGGAGGTGTGGAGGG + Intronic
1122611369 14:102985442-102985464 GGGTGGTGTGGAGGTGTGGAGGG + Intronic
1122791418 14:104185609-104185631 GGGTGGGTTGGGGGAGTAAAGGG + Intergenic
1124363290 15:29054289-29054311 GGAGGCGGTGGAGGAGTGGACGG + Exonic
1124720242 15:32105407-32105429 GGAGGAGGTGGAGGAGGAGAAGG + Intronic
1124813866 15:32968855-32968877 GGGGGTGGTGGAGCAGGAGGAGG + Exonic
1124957779 15:34370935-34370957 GGGGGAGGGGGAGGAGGAGAAGG - Intergenic
1125320699 15:38484480-38484502 GGGTGGGGGGGAGGAGGAGGAGG + Exonic
1125321332 15:38492861-38492883 GGGTGGGGAGGAGTAGGAGACGG - Intronic
1125506091 15:40268488-40268510 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
1126356178 15:47799000-47799022 GGATGTGAAGGAGAAGTAGAAGG + Intergenic
1127207150 15:56733167-56733189 GGAGGTGGCGGAGGAGCAGAAGG + Intronic
1127251950 15:57247973-57247995 GGGTGGGGTGGTGGGGGAGAAGG - Intronic
1127530402 15:59837963-59837985 GTTTGTGGTGGAGGATGAGATGG - Intergenic
1127661180 15:61101744-61101766 GTGTGTGGTGGAGGAAAAGGAGG + Intronic
1127724172 15:61731622-61731644 GTGGGGGGTGGAGGAGGAGAGGG + Intergenic
1127828449 15:62727236-62727258 GGGTGTAGTGGGGGAGGAGGAGG + Intronic
1128304125 15:66586964-66586986 GGGGGAGGAGGAGGAGGAGAAGG - Intronic
1129109244 15:73328120-73328142 GAGTGTGGTGAAGGAGGAGAGGG + Intronic
1129113759 15:73353583-73353605 GGGTGTGGAGGGGGAGTAATAGG - Intronic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129288272 15:74542840-74542862 GGGAGAGGTGGGGGAGTAAAAGG + Intronic
1129333847 15:74840987-74841009 GGGTGTGGTGGGGGAGTAGGAGG - Intronic
1129419772 15:75415420-75415442 GGGTGTGGTGGTGATGTGGAAGG - Intronic
1129538946 15:76335962-76335984 GGAGGTGGTGGTGGAGGAGAGGG + Intergenic
1129771868 15:78207926-78207948 GGGTGTGCTGGAGGGGTGGGTGG - Intronic
1130311035 15:82754521-82754543 GTGTGTGCTTGGGGAGTAGAAGG - Intergenic
1130319704 15:82830878-82830900 GGTGGTGGTGGAGGAGGAGGAGG - Exonic
1131356393 15:91749954-91749976 GGAGGTGGTGGAGGTGGAGATGG + Intergenic
1131514417 15:93067651-93067673 GGGTGTGGTGGGGTGGTATATGG + Intronic
1131675592 15:94667317-94667339 GGTGGTGGTGGAGGTGGAGATGG - Intergenic
1131714606 15:95094809-95094831 GGGAGGGGTGGAGGGGTGGAGGG - Intergenic
1132040574 15:98521920-98521942 GGGTGAGGAGGAGGAGGAGGAGG - Intergenic
1132079741 15:98853814-98853836 GGGAGTGGAGGAGGAGGGGAAGG + Intronic
1132140612 15:99390341-99390363 GAGTGTGGTGGATGGGCAGAAGG + Exonic
1132246972 15:100305110-100305132 TGTTGTGGTGCAGGAGCAGAGGG + Intronic
1132338933 15:101065962-101065984 GGGTGGGGATGAGGAGTAGGAGG - Exonic
1133494201 16:6300778-6300800 GGAGGTGGTGGTGGAGTAAATGG - Intronic
1133639138 16:7700002-7700024 GGGTGTGTTGGTGCTGTAGAGGG + Intronic
1133832177 16:9333307-9333329 GGATGTGGGGGAGGAGTGGCAGG + Intergenic
1134111754 16:11519344-11519366 GTGTGTGGTGGATGAGTGGAGGG + Intronic
1134549433 16:15132240-15132262 GGGGCTGGGGGAGGAGTGGAGGG + Intronic
1134710870 16:16326476-16326498 GGGGCTGGGGGAGGAGTGGAGGG - Intergenic
1134869240 16:17636849-17636871 GGGAAGGGTGGAGGAGGAGAAGG - Intergenic
1134948731 16:18342169-18342191 GGGGCTGGGGGAGGAGTGGAGGG + Intergenic
1135176700 16:20236242-20236264 GTGTGTGGTGGAGGACATGAAGG - Intergenic
1135259517 16:20968767-20968789 GGGTGGGGTGGAGCAGGAGTGGG - Intronic
1135721842 16:24824109-24824131 GGGGGTTGGGGAGGAATAGAAGG - Exonic
1136547922 16:30965820-30965842 GGGGGTGGTGGAGGAGGTGGGGG - Exonic
1137434614 16:48445264-48445286 GTGTGTGGTGGGGGAGTGAAGGG + Intronic
1138112671 16:54337142-54337164 GGAGGTGGAGGAGGAGGAGAAGG + Intergenic
1138320222 16:56105328-56105350 GTGTGGGGTGGAGGTGTGGAGGG - Intergenic
1138681629 16:58687759-58687781 GGGCTTGGTGGAGGGGGAGATGG - Intergenic
1139394567 16:66630290-66630312 GGGTGAGGGGGAGGGGGAGAGGG - Intronic
1139411656 16:66766455-66766477 GGGTGTGAAGGAGGAGGAGAAGG + Intronic
1139446172 16:67000171-67000193 GAGTGTGGCCGAGGAGTAGGAGG + Intronic
1139686133 16:68605147-68605169 GTCTGGGGTGGAGGAGGAGAGGG - Intergenic
1139946265 16:70644692-70644714 GGGTGAGGAGGAGGAGGAGGGGG + Intronic
1140015120 16:71175084-71175106 GTGGGTGGTGGTGGTGTAGATGG - Intronic
1140052922 16:71498793-71498815 GGGTGTGCTCGGGGAGAAGAGGG - Intronic
1140114040 16:72026325-72026347 GGAAGGGGTGGAGGAGAAGAGGG + Intronic
1140264406 16:73408040-73408062 GGGTGAGCTGCAGGAGTGGATGG + Intergenic
1140494141 16:75368367-75368389 GGTTTTGGTGGTGGAGTGGATGG + Intronic
1141413261 16:83850852-83850874 GGGTGAGGTAGAGGACTTGAGGG - Intergenic
1141560797 16:84866572-84866594 GGGTCAGGTGGAGGAGGAGATGG + Intronic
1141607351 16:85162002-85162024 GGGTGCGCTGGAGGTGTTGAGGG + Intergenic
1141616885 16:85214846-85214868 GGGGGTGGGGCAGGAGGAGAAGG + Intergenic
1141947687 16:87321863-87321885 GGGTGTGGTGGTGGTGGTGATGG - Intronic
1142411495 16:89919296-89919318 GGCTGTGGGGGTGGAGTTGAGGG - Exonic
1142421023 16:89970189-89970211 GGCAGTGGGGGAGGAGGAGAGGG - Exonic
1203141682 16_KI270728v1_random:1771357-1771379 GGCTGGGATGGAGGAGAAGAGGG - Intergenic
1203141699 16_KI270728v1_random:1771404-1771426 GGCTGGGATGGAGGAGAAGAGGG - Intergenic
1142759538 17:2034775-2034797 GGGAGTGGGGGAGGAGGGGAGGG - Intronic
1142987980 17:3708760-3708782 GGGTCAGGTGGGGGAATAGAGGG - Intergenic
1143149850 17:4801125-4801147 GTGTGTGCTGGGGGTGTAGATGG - Intergenic
1143176906 17:4960624-4960646 GGGTGCTGGGGAGGCGTAGAAGG - Intronic
1143340731 17:6208773-6208795 TGGTCTGGTGGAGGAGGAGGAGG + Intergenic
1143447746 17:7019060-7019082 GAGGGTGGTGGAGGAGCAGGAGG - Intergenic
1143478976 17:7217923-7217945 GGGTGTGAGGGAGGAGCTGAAGG + Intronic
1143611726 17:8021847-8021869 GGGTGAGGAGGTGGAGTAGATGG - Intergenic
1143963940 17:10742616-10742638 TGGTGTGTTGGAGGGGTAGCTGG - Intergenic
1143978462 17:10847251-10847273 GGGTGTGGTGGTGGTGGTGATGG + Intergenic
1144110591 17:12027773-12027795 GGTTGTGGCAGAGGTGTAGAGGG + Intronic
1144447846 17:15347501-15347523 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447858 17:15347544-15347566 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447870 17:15347587-15347609 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1145240024 17:21235751-21235773 TGGTTTGGTGGATGAGTGGATGG - Intergenic
1145895005 17:28451204-28451226 TGGTGAAGTGGAGGAGAAGAGGG - Intergenic
1145936356 17:28717150-28717172 GGGTGTGGGCGAGGAGGAGGCGG - Intronic
1145941754 17:28746383-28746405 GGGTTTGGTGCAGGAGAAGGCGG + Intronic
1146256235 17:31392624-31392646 GGGAGTGGTGGCTGAGCAGAGGG + Intronic
1147459468 17:40559137-40559159 GGGAGTGGAGGAGGACAAGAAGG - Intronic
1147607815 17:41784389-41784411 GGATGCGGGGGAGGAGGAGAAGG - Intronic
1147659899 17:42111918-42111940 GGGAGGGGTGGAGGAGTCGGTGG - Intronic
1148128338 17:45248052-45248074 GGAGGAGGTGGAGGAGGAGACGG + Intergenic
1148334501 17:46832404-46832426 GGGGGTGGTGGAGGAGAGAAGGG + Intronic
1148555686 17:48577538-48577560 GGAGGAGGTGGAGGAGGAGAAGG - Intronic
1148582203 17:48752004-48752026 GGCTGGGGTGGAGGAGTGTATGG + Intergenic
1148688837 17:49515178-49515200 GGGTGAGGTGGGGAAGGAGAAGG + Intergenic
1148744735 17:49911913-49911935 GGCTCTGGAGGAGGAGTTGAGGG - Intergenic
1149428321 17:56576779-56576801 GGGAGTGGTGGTGGGGTAGGAGG + Intergenic
1149497872 17:57131550-57131572 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149497881 17:57131574-57131596 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149497890 17:57131598-57131620 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149497899 17:57131622-57131644 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149497908 17:57131646-57131668 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149497988 17:57131862-57131884 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149498049 17:57132030-57132052 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149498058 17:57132054-57132076 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498067 17:57132078-57132100 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498076 17:57132102-57132124 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498130 17:57132246-57132268 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498139 17:57132270-57132292 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149498148 17:57132294-57132316 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149498157 17:57132318-57132340 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498166 17:57132342-57132364 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498222 17:57132486-57132508 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498231 17:57132510-57132532 GGGTGTGTTGGAGGGGGTGAGGG + Intergenic
1149498240 17:57132534-57132556 GGGTGTGCTGGAGGGGGTGAGGG + Intergenic
1149512690 17:57256441-57256463 GGGGGAGGAGGAGGAGGAGATGG + Intronic
1149779774 17:59388158-59388180 TGGTGTGGGGGCGGAGAAGAGGG - Intronic
1150001843 17:61445189-61445211 GGGTGTGGGGTAGGAGAAGAGGG + Intergenic
1150477760 17:65487741-65487763 GGGAGAGGGGGAGGAGTAGAGGG + Intergenic
1151340039 17:73465321-73465343 GGGTTTGGTGCTGGAGTGGATGG + Intronic
1151358233 17:73572812-73572834 GATTGGGGTGGAGGAGTAGATGG - Intronic
1151504708 17:74520075-74520097 GGGGCTGGTGGAGGAGTGGGAGG + Intergenic
1151821719 17:76500547-76500569 GGGTGTGTCTGAGGAGCAGAAGG - Intronic
1151886391 17:76925481-76925503 GGGTGGGGTGGAGGAAGAGAGGG - Intronic
1151967137 17:77437333-77437355 GCGTGGGGTGGGGGTGTAGAAGG - Intronic
1151979366 17:77499504-77499526 GAGTCTGGTGGAGGAGCTGAGGG + Exonic
1152277627 17:79367352-79367374 GGATGTGGAGGAGGAGTAGGAGG - Intronic
1152315936 17:79580238-79580260 GGGGGAGGAGGAGGAGGAGATGG - Intergenic
1152336693 17:79703032-79703054 GGGAGGGGTGGAGGAGGAGTGGG - Intergenic
1152473521 17:80503376-80503398 GGGATGGGTGGAGGGGTAGAGGG + Intergenic
1152473541 17:80503444-80503466 GGGATGGGTGGAGGGGTAGAGGG + Intergenic
1152701874 17:81823439-81823461 GGGCCTGGTGGAGGAGTATGTGG - Exonic
1155547581 18:26930941-26930963 GGGTGGGGTGGGGGAGGAGAGGG + Intronic
1156003946 18:32418368-32418390 AGGTGTGTGGGATGAGTAGAGGG - Intronic
1156791711 18:40983872-40983894 GGAGGAGGAGGAGGAGTAGAAGG - Intergenic
1156835611 18:41550274-41550296 GGGAGTGGAAGAGAAGTAGAAGG + Intergenic
1157276063 18:46311874-46311896 GGATGTGGCGGAGGAGGAGGAGG + Intergenic
1157297259 18:46455328-46455350 GGGTGTTGAGGGGGAGTGGATGG + Intronic
1157516690 18:48316343-48316365 GGGGGTGGAGGAGGAGTGGTGGG - Intronic
1157572193 18:48720618-48720640 GGGCGTGAGGGAGGAGGAGAAGG - Intronic
1157617280 18:48994744-48994766 AGGGGTGGGGGAGGAGTAAAGGG - Intergenic
1158525521 18:58209394-58209416 GGGGGAGGTGGAGGAGGAGGAGG - Intronic
1158804193 18:60949790-60949812 GGGTGGGGTGAATGAGTAGGAGG - Intergenic
1159415127 18:68137308-68137330 GGGTGTGGTGGACAAGGTGAGGG - Intergenic
1159590100 18:70324976-70324998 GGGTGCTGAGGAGGAGGAGAAGG - Exonic
1160063419 18:75552060-75552082 GGGGGTGGTGGAGGAGAAGGGGG + Intergenic
1160254213 18:77233830-77233852 GGGTGAGGAGGAGGAGGGGAGGG - Intergenic
1160550455 18:79691537-79691559 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550470 18:79691575-79691597 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550513 18:79691687-79691709 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550528 18:79691725-79691747 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550583 18:79691875-79691897 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550598 18:79691913-79691935 TGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550613 18:79691951-79691973 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160550628 18:79691989-79692011 CGGGGTGGGGGAGGAGTGGACGG + Intronic
1160600448 18:80008637-80008659 GGGTGGGGTGGAGGAGAACGGGG - Intronic
1160926810 19:1550386-1550408 GTGGATGGTGGATGAGTAGATGG - Intergenic
1160971383 19:1769243-1769265 GGAGGTGGTGGAGGAGGAGGAGG + Intronic
1161319351 19:3633849-3633871 GGCTGTGGAGGAGGAGGAGGAGG - Intronic
1161828562 19:6586242-6586264 GGCCGTCGTGGAGGAGCAGATGG + Exonic
1162024287 19:7884729-7884751 GGGGGAGGAGGAGGAGGAGAAGG + Intergenic
1162053057 19:8046711-8046733 GGATGGGGAGGAGGAGGAGAAGG - Intronic
1162134081 19:8544548-8544570 GGAGGGGGTGGAGGAGTGGAGGG + Intronic
1162180873 19:8867843-8867865 GTGGGTGGTGGATGAGTGGATGG + Intronic
1162950786 19:14071132-14071154 GTGTGTGGTGGAGGACGACAAGG + Intergenic
1163011485 19:14429225-14429247 GGGTGGGCTGGAGAATTAGAGGG + Intergenic
1163129113 19:15261114-15261136 GGGAGCGGTGGAGGAGTTGAAGG + Intronic
1163628094 19:18402293-18402315 GGGTTTGGTGGGGGGGTATAGGG + Intergenic
1163692645 19:18745804-18745826 GGGTCTGGGGGAGGAGGAGATGG - Exonic
1164441671 19:28284375-28284397 GGGAAAGGTGGAGGAGAAGAAGG + Intergenic
1164528940 19:29032725-29032747 GGGTGTGGAGGTGGAGAAAAGGG + Intergenic
1164681160 19:30134674-30134696 GGTTGTGAGGGAGGAGTAGTAGG + Intergenic
1164718657 19:30415140-30415162 GGGGGAGGGGGAGGAGAAGAAGG - Intronic
1164796497 19:31037747-31037769 GGCTGTGCTGGAGCAGTAGGAGG - Intergenic
1165018344 19:32901360-32901382 GGCTGAGATGGAGGAGTTGATGG - Exonic
1165324087 19:35104164-35104186 TGGTGTGTTGGAGGAGTGGTGGG + Intergenic
1165420653 19:35720578-35720600 GGGAGGGGTGGAGGAGGTGAAGG - Exonic
1165705665 19:37974601-37974623 GGGTGAGATGCAGGAGCAGAAGG + Intronic
1165993212 19:39827471-39827493 GGGTGTGCTGGAGGTGGAGGGGG - Intronic
1166012268 19:39951260-39951282 GAGGGTTGTTGAGGAGTAGAAGG + Intergenic
1166550997 19:43666007-43666029 GGGTGTGGGGGAGGGATAGATGG - Intronic
1166713794 19:44953729-44953751 GGATGGGGTGGAGGAGCTGAGGG + Intronic
1166925231 19:46262165-46262187 GGGGGTGGAAGTGGAGTAGACGG + Intergenic
1167081110 19:47276518-47276540 GGGAGTGGTGGTGGGGTAAAGGG - Intergenic
1167114378 19:47480248-47480270 GGGTGGGGTTGAGGGCTAGAGGG - Intronic
1167364325 19:49046960-49046982 GGGAGGGGTGGAGGAGGGGAAGG + Intergenic
1167426909 19:49434221-49434243 GGGTCTGGGGGAGGAGGAGCTGG - Intronic
1167457015 19:49601673-49601695 GGGGGTGGTGGTGGAGGCGAGGG - Exonic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167798736 19:51726970-51726992 GGGTCTGAGGGAGGAGGAGATGG - Intergenic
1168053901 19:53850198-53850220 GGGGGTGGAGGAGGAAGAGAGGG + Intergenic
1168058475 19:53877024-53877046 GGGTGGGATGGAGGAGAAGGAGG - Intergenic
1168147815 19:54429635-54429657 GGGTGTGAGGGAGGAGAAGCTGG + Intronic
1168238106 19:55076115-55076137 GGGTCTGAGGGAGGAGGAGATGG + Intronic
1168238227 19:55076511-55076533 GGGTGTGGGTGAGGAGGCGAGGG - Intronic
1168327703 19:55546601-55546623 GGGTGTGAGGGAGGAGGAGCTGG - Intergenic
1168695823 19:58404171-58404193 GGGTGGAGCAGAGGAGTAGAGGG - Intronic
925398242 2:3552550-3552572 GGGGGTGGTGGTGGTGTGGAGGG - Intronic
925398253 2:3552575-3552597 GGGGGTGGTGGTGGTGTGGAGGG - Intronic
925462000 2:4071582-4071604 GTGTGTGGTGGGGCAGGAGAAGG - Intergenic
925633207 2:5916094-5916116 GGGTGTGGCTGAGCAGGAGAAGG - Intergenic
926648408 2:15315263-15315285 GGGTTTGGTTGATGAATAGAGGG + Intronic
927517317 2:23679976-23679998 GGGAGTGGAGGAGGAGCGGAGGG + Intronic
927596673 2:24403243-24403265 GGGGGTGGTGGAGTGGTGGAGGG - Intergenic
928010162 2:27599887-27599909 GGGTGTTGAAGAGGAGGAGAGGG + Intronic
928313738 2:30231114-30231136 GGCTGGGGTGGAGGAGTGGCGGG + Intergenic
928673937 2:33632002-33632024 GGAGGTGGTGGAGGAGGAGGAGG - Intergenic
928900965 2:36317072-36317094 GGGAGTGGTTGAGGTGTGGAAGG + Intergenic
929212548 2:39373800-39373822 GGGCTTGGTGGGGGGGTAGAAGG + Intronic
929592872 2:43158349-43158371 GGGTGAGGAGGAGGAGCTGAAGG - Intergenic
930241214 2:48937577-48937599 GTGTGTGCTGGAAGGGTAGATGG - Intergenic
930707587 2:54519943-54519965 GGGAGTGGTGGAGGAGATGCAGG + Intronic
930873508 2:56189841-56189863 GGGTGAGGGGAAGGAGTGGATGG + Intronic
931017954 2:58007443-58007465 GGGTGGGGAGGAGGAGGAAAAGG - Intronic
931235116 2:60406435-60406457 GGGTGTGGGGGAGGAAGAGGCGG - Intergenic
931265446 2:60656169-60656191 GGGTGTGGTGGAGAAAGAAAAGG + Intergenic
932312443 2:70754595-70754617 GAGAGTGGTGGAGGGGAAGATGG - Intronic
932338801 2:70946735-70946757 GAGTGTGGTGGAGGTGGAGAGGG - Intronic
932474335 2:71992208-71992230 GAGGGTGGTGGAGGTGGAGAGGG - Intergenic
932617661 2:73244971-73244993 GTGGGTGGTGGAGGGGTAGTAGG + Intronic
932623002 2:73277152-73277174 GTGTAAGGTGGAGGAGGAGAGGG + Intronic
932716137 2:74101645-74101667 GGGAGCGGTGAAGGAGGAGAAGG + Exonic
932745465 2:74330283-74330305 GAGTGTGGTGTAGGTGTAGGTGG + Intronic
933249704 2:80015522-80015544 GGGTGAAGTAGAGGAGAAGATGG + Intronic
934138340 2:89019483-89019505 GGGGGAGGTGGAGGAGGGGAGGG + Intergenic
934144418 2:89077510-89077532 GGGGGAGGTGGAGGAGGGGAGGG + Intergenic
934224833 2:90123039-90123061 GGGGGAGGTGGAGGAGGGGAGGG - Intergenic
934230911 2:90181142-90181164 GGGGGAGGTGGAGGAGGGGAGGG - Intergenic
934752059 2:96799804-96799826 GGGTGGTGTGGAAGAGCAGAGGG + Intronic
935435069 2:103021995-103022017 GGAAGTGATGGAGGAATAGAAGG - Intergenic
936465124 2:112741334-112741356 AGGTGTGGTGTAAGGGTAGAAGG - Intronic
936507627 2:113120083-113120105 GGAGGTGGAGGAGGAGGAGAAGG + Exonic
937308732 2:120888166-120888188 GGGAGTCGGGGAGGGGTAGAAGG + Intronic
937440064 2:121907911-121907933 AGGTGGGGTGGAGGAGTAAGGGG + Intergenic
937611699 2:123869459-123869481 TGGAGTGGTGGGGGAGGAGAGGG + Intergenic
937977723 2:127591895-127591917 GGCTGGGGCGGAGGAGTGGAGGG - Intronic
938072445 2:128315867-128315889 GGGAGTGGAGGCGGAGAAGAGGG + Intronic
938399441 2:130976679-130976701 GGATGTGGTGGAGAAGGAAAAGG + Intronic
938546934 2:132342139-132342161 GGGTGTGTAGGAGGAGAAGTAGG - Intergenic
939997832 2:148936958-148936980 GGGTGAGGAGGAGGAGGAAAAGG - Intronic
940034131 2:149295494-149295516 GGTTGTTTTGGTGGAGTAGAAGG + Intergenic
940085060 2:149849940-149849962 TGGTGGGATGTAGGAGTAGAAGG + Intergenic
940324765 2:152413513-152413535 GGGCATGGGGGAGGAGGAGAAGG + Intronic
940361884 2:152804849-152804871 GGGTGTTGTGGAGCAGAGGATGG + Intergenic
941677649 2:168361296-168361318 GTGTGTGGTGGGGGAGGAGTTGG + Intergenic
941728024 2:168885577-168885599 GGGAGTGGTGGAGAAGTGGCTGG - Intronic
941925381 2:170889112-170889134 GAATGTGTTGGAGGAGTATAAGG - Intergenic
942058559 2:172207115-172207137 GTCTGGGGTGGAGGAGTAGGTGG + Intergenic
942187273 2:173436287-173436309 GGAGGTGGTGGAAGATTAGAGGG + Intergenic
942571460 2:177319672-177319694 GGCTGAGGTGGAGGTGTTGAGGG + Intronic
942927102 2:181447088-181447110 GGGTGGGGTGGAGGGGTGCATGG - Intergenic
943785414 2:191872402-191872424 GGGGGTGGTGGGGGGGCAGAGGG - Intergenic
944065292 2:195613166-195613188 GGGTGGGGTGGGGGAACAGAAGG - Intronic
944201756 2:197115012-197115034 GGTTGTGTTGGAGAAGTTGAAGG - Intronic
944599653 2:201290383-201290405 GGGTGGGGTGGGGTAGTATATGG + Intronic
944675908 2:202034114-202034136 GGGTGTGGAGGAGGAGGCGAAGG + Intergenic
944822105 2:203441268-203441290 GGGGGTGGTGGAGGAGGAGGTGG + Exonic
945436183 2:209820560-209820582 GGAGATGGTGGAGGAGAAGAAGG + Exonic
945823983 2:214698074-214698096 GGGTGAGGAGTAGGAGGAGAGGG - Intergenic
945870263 2:215219390-215219412 GGGTGTGGTGGAGTAGGGGGTGG - Intergenic
945906295 2:215597307-215597329 GGGTGTGGAGGAAGGGCAGAGGG - Intergenic
946121093 2:217515568-217515590 GGGAGGTGTGGAGGAGAAGAGGG - Intronic
946193918 2:218022142-218022164 GAGTGAGCTGGAGGAGGAGAGGG + Intergenic
946275660 2:218629734-218629756 GGGGAGGGTGGAGGAGTACAGGG + Intronic
946340435 2:219063300-219063322 GTGTGTGCTGGAGAAGCAGAGGG + Intergenic
946399378 2:219460676-219460698 TGGTGTGGAGGGGGAGGAGAGGG - Intronic
947698259 2:232211109-232211131 GGGGGAGGTGGAGGAGGAGGAGG - Intronic
947714595 2:232333306-232333328 GGGGGTGGGGGAGGAGGAGGAGG - Intronic
947817453 2:233047787-233047809 GGGTGTCCTGGAGGAGGAGGCGG + Intergenic
1168844640 20:935490-935512 GGGGGTGGGGGAGGATTAGATGG + Intergenic
1169189300 20:3647568-3647590 GGGTGAGATGGAGAAGGAGAGGG - Exonic
1169207380 20:3748101-3748123 GGGTGTGATGGAGGAGGAGGTGG + Intronic
1169411035 20:5370612-5370634 GAGGGAGGTGTAGGAGTAGAAGG - Intergenic
1169492176 20:6080587-6080609 GGTGGTGGTGGAGGAGGAGGCGG + Intronic
1169997307 20:11572526-11572548 GGGTGTGGCGGGGGAGGGGAGGG + Intergenic
1170312601 20:15008913-15008935 GGGTTTAGTGGAGGAGGAGTTGG + Intronic
1170647322 20:18209159-18209181 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647331 20:18209201-18209223 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647338 20:18209242-18209264 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647357 20:18209335-18209357 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647366 20:18209376-18209398 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647393 20:18209540-18209562 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647400 20:18209582-18209604 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647407 20:18209623-18209645 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647435 20:18209789-18209811 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647442 20:18209830-18209852 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647449 20:18209872-18209894 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647458 20:18209914-18209936 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647478 20:18210037-18210059 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647487 20:18210079-18210101 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647494 20:18210120-18210142 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647508 20:18210202-18210224 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647522 20:18210285-18210307 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647531 20:18210327-18210349 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647538 20:18210368-18210390 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647553 20:18210450-18210472 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1170647567 20:18210533-18210555 GGGTGTGGGGAAGGTGTGGAAGG - Intergenic
1170647589 20:18210655-18210677 GGGTGTGGAGAAGGTGTGGAAGG - Intergenic
1171070486 20:22063305-22063327 AGGTGAGGAGGAGGAGGAGAAGG - Intergenic
1171096875 20:22340764-22340786 GGTTGTTGGGGATGAGTAGAGGG + Intergenic
1171123656 20:22584664-22584686 GGTGGTGGTGGAGGAGGAGGAGG + Intronic
1171234544 20:23513570-23513592 GTGTGTGGTGGAGGGGGGGAGGG - Intergenic
1171870397 20:30520312-30520334 GGGTGTGGTTGGAGAGTAGCTGG + Intergenic
1171875799 20:30574872-30574894 GGGTGTGTAGGAGGAGAAGTAGG - Intergenic
1172437965 20:34943479-34943501 TGCTGTGGAGGAGGAGGAGAAGG - Intronic
1172870372 20:38132002-38132024 GGGTGGGGTGGGGGAGTGAAGGG - Intronic
1172981001 20:38941629-38941651 GAGTTTAGTGGAGGAATAGAAGG + Intronic
1173180786 20:40804845-40804867 CAGGGTGGTGGAGGAGAAGATGG - Intergenic
1173430409 20:42982745-42982767 GGGTGTGGGAGAGGAGCAGAGGG - Intronic
1174053649 20:47784395-47784417 GGGGGAGGAGGAGGAGGAGAGGG + Intronic
1174339493 20:49886969-49886991 GGGTGGGGTGGAGGAAGAGTGGG + Intronic
1174650157 20:52118205-52118227 GGGTGGGGTGTGGGAGCAGAGGG - Intronic
1175339934 20:58222230-58222252 GAGTGTGGAGGAGGAGGAGCGGG + Intronic
1175402986 20:58711119-58711141 GCGTGGGGAGGAGGAGGAGAGGG - Intronic
1175607148 20:60320614-60320636 GGGTCTGGTGGAAGAGGAAAAGG - Intergenic
1175934628 20:62509272-62509294 GTGGAAGGTGGAGGAGTAGAGGG - Intergenic
1175934756 20:62509605-62509627 TGGAGGGGTGGAGGGGTAGAGGG - Intergenic
1175934803 20:62509737-62509759 TGGAGGGGTGGAGGAGTGGAGGG - Intergenic
1175977630 20:62719583-62719605 GGGGCTGGGGGAGGAGGAGATGG - Intronic
1175983976 20:62755164-62755186 GGGAGGGGTGGAGGGATAGAAGG - Intronic
1176180007 20:63745384-63745406 GGGTCCTGTGGAGGAGTACATGG - Exonic
1176414641 21:6467632-6467654 GGGTGGGGTGGAGGAGGGGCTGG - Intergenic
1176551270 21:8223464-8223486 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176570179 21:8406463-8406485 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176578088 21:8450650-8450672 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1176877335 21:14145644-14145666 GGCGGAGGTGGAGGAGAAGAAGG + Intronic
1177907634 21:26991549-26991571 GGGGGTGGTGGGGGGGTAGCGGG + Intergenic
1178222915 21:30681352-30681374 GGGTGAGCAGGAAGAGTAGAGGG + Intergenic
1178529215 21:33361224-33361246 GGTAGTGGTAGAGGACTAGATGG - Intergenic
1179066423 21:38028788-38028810 GGTGGTGGTGGAGGAGGAGGAGG + Intronic
1179193197 21:39140795-39140817 GGGGGTGGTGGGGGAGAAAAAGG - Intergenic
1179690141 21:43075954-43075976 GGGTGGGGTGGAGGAGGGGCTGG - Intronic
1179939617 21:44629105-44629127 GGGTGTGGGTGAGGACTGGAGGG - Intronic
1179982993 21:44906074-44906096 AGGTGTGGTGGTGCAGCAGATGG - Intronic
1180081575 21:45489958-45489980 GGGTGTGGGGGAGGAGGTGTGGG - Intronic
1180081594 21:45489999-45490021 GGGTGTGGGGGAGGAGGTGTGGG - Intronic
1180257420 21:46641780-46641802 GGGCATGGTGGAGGTGTGGAAGG + Intronic
1180352269 22:11815035-11815057 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1180353222 22:11820518-11820540 GGGCGTGGTGGGAGAGTAGCTGG - Intergenic
1180385019 22:12171839-12171861 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1180385939 22:12177031-12177053 GGGCGTGGTGGGAGAGTAGCTGG - Intergenic
1180615405 22:17122764-17122786 GTGTGTGGGGGAGGTGGAGATGG - Intronic
1180715627 22:17870246-17870268 GGGTATGGTGACTGAGTAGAGGG - Intronic
1181281203 22:21721872-21721894 GGGCTTGGTGGAGGAGGAAATGG - Intronic
1181431910 22:22887027-22887049 GGCAGTGGTGGAGGAGGAGAGGG - Intronic
1181490092 22:23256234-23256256 GGGTGGCGTGCAGGAGGAGAGGG - Intronic
1181621648 22:24095420-24095442 GGGTGTGGTGGGGGGGTGGGTGG - Intronic
1181632185 22:24157069-24157091 GGGTGGGGTGTAGGAGTGGGCGG + Intronic
1181792508 22:25278663-25278685 GGGTGAGGGGGAGGGGGAGAGGG + Intergenic
1182088753 22:27579776-27579798 GGGTGTGAGGAAGGAGGAGAAGG + Intergenic
1183747153 22:39698534-39698556 GGGAGTGATGGAGGAGGTGATGG - Intergenic
1183818877 22:40327741-40327763 GAGTGTGGTAGAAGAGAAGAAGG - Exonic
1184348108 22:43925285-43925307 GTGTGTGGTGGGGGTGCAGACGG + Intronic
1184852290 22:47127936-47127958 GGGTGGGGTGGAGGAGAGGATGG - Intronic
1185414351 22:50701616-50701638 GGGTGTGATGGAGGAAAGGAGGG + Intergenic
949243624 3:1900059-1900081 GAGTGTGGTGGATGAGGATAGGG - Intergenic
949899144 3:8795333-8795355 GGATGTGGTGGAGGAACACATGG + Intronic
950205463 3:11076849-11076871 GGGCGAGGTGGAGGAGGAGCAGG - Intergenic
950289078 3:11769042-11769064 GGGTGGAGGGGAGGAGTGGAAGG + Intergenic
950539140 3:13599622-13599644 GGGGGTGGTGGAGGAGGAGGTGG + Intronic
950710237 3:14808948-14808970 GAGTGAGGTGGTGGAGTTGAGGG - Intergenic
950717808 3:14862162-14862184 GGATGTGGAGGAGGAGTGGTAGG + Intronic
950791384 3:15475000-15475022 GAGTTTGGTGGAAGAATAGAAGG + Intronic
952017548 3:28976209-28976231 GGGTGGGGAGGAGGAGAAGGAGG - Intergenic
953026317 3:39147305-39147327 GGATGTGCTGGAGGAGGAGGAGG - Intronic
953563861 3:44014614-44014636 GGGTGGGGTTGAGGGGCAGATGG - Intergenic
953715143 3:45311301-45311323 GGGTTTGGGCGGGGAGTAGAGGG + Intergenic
954149559 3:48650641-48650663 GGGGGTGGTGGAGGGGCAGTGGG - Intronic
954839138 3:53495612-53495634 GGGGGCGGGGGAGGAGTGGAAGG - Intronic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
955876753 3:63498654-63498676 TGGTGTGGTAAAGGAATAGAAGG + Intronic
955961472 3:64345351-64345373 GGGTGGGGTGGAGAGGAAGAGGG - Intronic
956253310 3:67256987-67257009 GGAGGTGGAGGAGGTGTAGAAGG + Intergenic
956307787 3:67845498-67845520 GGAAGTGGTGGAGGAGAAGGTGG - Intergenic
957803136 3:85111623-85111645 GGTTGTGGAGGAGGTGGAGATGG + Intronic
958294914 3:91891419-91891441 GGGCGTGGTGGGAGAGTAGCTGG - Intergenic
959084100 3:101833345-101833367 GGGTGTGGAAGGGGAGGAGAAGG - Intronic
959963819 3:112332233-112332255 GGGGGAGGGGGAGGAGGAGAAGG + Intergenic
960187226 3:114658831-114658853 TGGTCTGGTGGAAGGGTAGATGG - Intronic
960532491 3:118780794-118780816 GGGTGTGCAGGAGGAGTGGTAGG - Intergenic
960629198 3:119711978-119712000 GGCAGTGGTGGAGGAGGAAAGGG + Intronic
961428618 3:126864576-126864598 GGAGGTGGTGGAGGTGGAGAAGG - Intronic
961428736 3:126865087-126865109 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
961428746 3:126865123-126865145 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
961428768 3:126865207-126865229 GGTGGTGGTGGAGGAGGAGGAGG - Intronic
961498776 3:127315663-127315685 TGGCATGGTGGAGGAGTGGAAGG - Intergenic
961554374 3:127688223-127688245 AAGTGTGCTGGAGGAGGAGAAGG + Intergenic
961951796 3:130757271-130757293 GGCTGTGGTGGAGGCCTAGCTGG + Intergenic
962083970 3:132171348-132171370 GGGAGGATTGGAGGAGTAGATGG - Intronic
962330232 3:134471832-134471854 GGGCATGGTGGAGGGGAAGAGGG + Intergenic
962367047 3:134793721-134793743 TGGTGGTGTGGAGGCGTAGAGGG + Intronic
963464920 3:145667242-145667264 GGGTGAGGAGGAGGAGGAAAAGG + Intergenic
963897627 3:150703718-150703740 GGAGGTGGTGGAGGAGGAGTTGG - Exonic
964714275 3:159705599-159705621 AGGTTTGGTGGAGGTGAAGATGG + Intronic
965604485 3:170485035-170485057 GGGAATGAAGGAGGAGTAGAAGG + Intronic
966629521 3:182057060-182057082 GGGTGGGGGGAAGGGGTAGAAGG - Intergenic
966645913 3:182246161-182246183 GGGTGTGGGGTGGGAGTAAAAGG + Intergenic
966649547 3:182284264-182284286 GGGTGAGGTGGAGGTGTGGGTGG - Intergenic
966823436 3:183943241-183943263 TGCTGTGGTGGAGGGGTGGAAGG - Intronic
966908511 3:184544582-184544604 GGGGGAGGAGGAGGAGTAGGAGG - Intronic
966908539 3:184544653-184544675 GGGGGAGGAGGAGGAGTAGGAGG - Intronic
967116954 3:186350245-186350267 GGGTGTGGTGGTGGGAAAGATGG - Intronic
967486833 3:190042091-190042113 TGCAATGGTGGAGGAGTAGAGGG + Intronic
967493258 3:190117280-190117302 TGGTGTGTTGGAGGGGAAGAAGG - Intronic
967553791 3:190831393-190831415 GGGAGTGGTGGAGGAGGTGGAGG - Intergenic
968133147 3:196203840-196203862 GGGTGTGGTGGAGTGATTGAAGG + Intronic
969370395 4:6727808-6727830 GGGGGTGGGGGAGGAGGGGAGGG - Intergenic
969370407 4:6727828-6727850 GGGGGTGGGGGAGGAGGGGAGGG - Intergenic
969370419 4:6727848-6727870 GGGGGTGGGGGAGGAGGGGAGGG - Intergenic
969553864 4:7892832-7892854 GGATGTGGTGGGGGAGCAGCGGG + Intronic
969606663 4:8205403-8205425 GGGTGGGGTGGAGAAGTGGGTGG - Intronic
969921084 4:10540428-10540450 GGGTGTGGGGGAGGGGGACAAGG - Intronic
970001201 4:11367785-11367807 GGAGGTGGAGGAGGAGGAGAAGG - Intergenic
970108571 4:12612169-12612191 GGGTGTGGGGGGAGAGTAGCAGG + Intergenic
970195567 4:13547561-13547583 AGGTGTGGAGGAGGAGGGGAGGG - Intergenic
971028038 4:22607660-22607682 GGGTGGGGTGGGGGAGGGGAGGG + Intergenic
971480295 4:27108921-27108943 GGGAGAGGTTGAGGAGCAGAGGG - Intergenic
972315771 4:37924180-37924202 GGGTGGTGTGGGGGAGGAGAGGG - Intronic
972352268 4:38246709-38246731 GGGTTTGGAGGAAGAGTTGATGG - Intergenic
972491928 4:39596051-39596073 GGGTGGGGTAGAGGAGTAGGAGG - Intronic
972706884 4:41553526-41553548 GGGTGTGGTGGGGGATGAGGAGG + Intronic
973374911 4:49279931-49279953 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
973375816 4:49285953-49285975 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973376716 4:49291972-49291994 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973377634 4:49298124-49298146 GGGCGTGGTGCGGGAGTAGCTGG + Intergenic
973378554 4:49304260-49304282 GGGCGTGGTGCGGGAGTAGCTGG + Intergenic
973380505 4:49317243-49317265 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973381594 4:49324288-49324310 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973382500 4:49330310-49330332 GGGCGTGGTGGGAGAGTAGCTGG - Intergenic
973386084 4:49515213-49515235 GGGTGTGGTTGGAGAGTAGCTGG - Intergenic
973386114 4:49515360-49515382 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
974028862 4:56757878-56757900 GCGTGTGGGGGAGGAGCAAATGG - Intergenic
974153548 4:58042127-58042149 GGGTGTGGAGGAGAAGACGAAGG - Intergenic
974273315 4:59680831-59680853 GTGTGTGGTGGAGGAGTTGGGGG - Intergenic
974388286 4:61231427-61231449 GGTTGTGGGGGCGGAGTGGAGGG + Intronic
974762764 4:66299947-66299969 GGTAGTGGTGGAGAAGGAGAAGG - Intergenic
975388519 4:73788118-73788140 GGATGAGGAGGAGGAGGAGAAGG + Intergenic
975388578 4:73788378-73788400 GGATGAGGAGGAGGAGGAGAAGG + Intergenic
975690777 4:76960794-76960816 TGGTTTGGTGGGGGAGTAGAAGG - Intronic
975985195 4:80196547-80196569 GCGGGTGGTGGAGGAGGGGATGG - Exonic
976623776 4:87156370-87156392 AGGTGGGGTGGAAGAGTGGAGGG + Intergenic
979876824 4:125902473-125902495 GGTTGTGATGGAGTAGTAAATGG - Intergenic
981254393 4:142644272-142644294 AGGAGTGGGGGAGGAGGAGAAGG + Intronic
981514026 4:145587766-145587788 GGGAGTGGAGGAGGAGGAGAAGG + Intergenic
981567507 4:146116104-146116126 GAGTGGGGTGGTGGGGTAGAAGG + Intergenic
982147441 4:152411449-152411471 GGATGAGGAGGAGGAGGAGATGG - Exonic
983828450 4:172295720-172295742 GTGTGTGTGGGAGGGGTAGAGGG - Intronic
984250508 4:177327575-177327597 GGGTGTGGGGGACAAGGAGAGGG - Intronic
984668551 4:182455439-182455461 GGGAGTGGAGGAGCAGTAGAGGG - Intronic
984852135 4:184163378-184163400 GGGTGGGGTGAAGAAGTAAAGGG + Intronic
986717684 5:10535569-10535591 GGGTGGGGTGGAAGGGTAGTGGG + Intergenic
986908343 5:12522207-12522229 GGGTGGGGTGGGGGAGCAGTGGG + Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
987715178 5:21559231-21559253 GGGAGTGAAGGAGGAGGAGAAGG + Intergenic
987767585 5:22253703-22253725 AGGAGAGGTGGAGGAGAAGAGGG - Intronic
988482427 5:31640866-31640888 GGGTTAGGTGTAGGAGTAGGGGG + Intronic
988498264 5:31762931-31762953 GTGTGTGGTGGAGGGGTCGGGGG - Intronic
988613833 5:32754177-32754199 GGATGTGGTGGAGGAGCCCAAGG + Intronic
988913774 5:35872042-35872064 GGGTGGGGTGGGTGAGTAGAAGG - Intronic
989096679 5:37788387-37788409 GGGTGTGGAGGGGAAGAAGAAGG - Intergenic
991613964 5:68476933-68476955 GGGTGGGGTGGTGGAGGGGATGG - Intergenic
992567213 5:78009776-78009798 GGGGGTGGGGGAGGGGGAGAGGG + Intronic
992732934 5:79690411-79690433 GGGTGGGGTGGAGGCGGTGAAGG + Intronic
993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG + Intronic
993861620 5:93143502-93143524 GGGGATGGTGGTGGGGTAGAGGG + Intergenic
993948996 5:94150395-94150417 GGGGGTGGGGGAGGAGGAAAAGG - Intergenic
995123109 5:108556088-108556110 GGGTGTGGTGATGGATTGGAGGG + Intergenic
995821336 5:116236680-116236702 GGGGGTGGGAGATGAGTAGATGG + Intronic
995907428 5:117142473-117142495 GGGGGAGGAGGAGGAGGAGAAGG - Intergenic
996032910 5:118726672-118726694 GGTTGAGGTGGAGAAGAAGATGG - Intergenic
996519264 5:124408742-124408764 GGGTTTGGTGAAGCAGAAGAAGG + Intergenic
997311978 5:132893842-132893864 GTGTCTGGGGGAGGAGGAGATGG - Intronic
997544067 5:134690670-134690692 GAGAGTGGTGGAGGATTACAAGG - Intronic
997670984 5:135671851-135671873 GGTGGGGGTGGGGGAGTAGAGGG - Intergenic
997745829 5:136299373-136299395 GTGTGTGGTGGAGGAGGAGGAGG + Intronic
997952417 5:138252929-138252951 GGGTGTGGTGGAGGGGAAGAGGG + Exonic
998121405 5:139581071-139581093 GGATGTGGGGGAGGAGAGGATGG + Intronic
998155932 5:139787297-139787319 GGGCGTGGGGGTGGAGTGGAGGG - Intergenic
998164448 5:139835024-139835046 GGGAGTGTTTGAGGAGTACAGGG - Intronic
998228243 5:140343150-140343172 GGGTGTGGGGGAGTAGGAGATGG - Intronic
998329098 5:141307713-141307735 GGGTGTGGTGGGGGAGAGGTAGG + Intergenic
998537724 5:142950186-142950208 GTGTGTAGTGGAGGAGTGAATGG + Intronic
999244282 5:150145055-150145077 GGAAGAGGTGGAGGAGTGGAAGG - Intronic
999432633 5:151537269-151537291 GGTGGTGGTGGAGGAGGAGGAGG + Intronic
999479567 5:151934997-151935019 GGGTGTGGTTTATGAGTAGTGGG - Intergenic
1000185277 5:158851967-158851989 GGGTGGGGAGGAGGGGGAGAAGG + Intronic
1001013400 5:168118795-168118817 GGAAGGGGAGGAGGAGTAGAAGG - Intronic
1001732021 5:173967730-173967752 GGGTGAGGAGGAGGAGTTTAAGG + Intergenic
1001770958 5:174295446-174295468 GTGTGGCGTGGAGGAGGAGAGGG + Intergenic
1001858668 5:175034197-175034219 TGGTCTGGTGGGGGAGCAGATGG + Intergenic
1002174374 5:177393273-177393295 GGGTGTCTTGGAGGAGAGGAAGG + Intronic
1002303759 5:178271876-178271898 GTAGGTGGTGGAGGAGCAGAGGG + Intronic
1002715625 5:181224791-181224813 GGAGGTGGTGCAGGAGTACAAGG + Exonic
1003323883 6:5077187-5077209 TAGTGAGGTGGTGGAGTAGACGG - Intergenic
1003350635 6:5314342-5314364 GTGTGTGGGGGTGGAGGAGAGGG + Intronic
1004178262 6:13359398-13359420 GGCGGTGGTGGAGCAGTAGGCGG + Exonic
1004380961 6:15132059-15132081 GGGTGAAGAGGAGGCGTAGAGGG + Intergenic
1004945590 6:20609294-20609316 GGGGGAGGAGGAGGAGGAGAAGG - Intronic
1005710693 6:28501524-28501546 GGGGGAGGTGGAGGGGGAGAGGG - Intergenic
1005765210 6:29004779-29004801 GGGAGTGGGAGAAGAGTAGAAGG - Intronic
1006185073 6:32176950-32176972 GGGAGTGGAGGAAGAGAAGAGGG - Exonic
1006268859 6:32948922-32948944 GGGGGAGGAGGAGGAGGAGAAGG - Intronic
1006304071 6:33208470-33208492 GGGTGTAGCGGAGGAGCAGGCGG + Intergenic
1006374923 6:33666849-33666871 GGGCCTGGGGGAGGAGCAGAGGG - Intronic
1006670368 6:35726521-35726543 GTGTGTGGAGGAGGAGGAGATGG - Intronic
1006678405 6:35779715-35779737 GGGTGTGGTGGAGCAGGGGCTGG + Intergenic
1007509219 6:42362658-42362680 GGATGCAGTGGAGGTGTAGAAGG - Intronic
1007524879 6:42483138-42483160 AAGTTTGGTGGAGGAGGAGAAGG - Intergenic
1007841584 6:44720454-44720476 GGGTGGGGGTGAGGGGTAGATGG + Intergenic
1008166785 6:48149079-48149101 GGCGGTGGTGGAGGATAAGATGG - Intergenic
1008423925 6:51334504-51334526 GGAGGTGGAGGAGGAGGAGAAGG - Intergenic
1008467605 6:51848025-51848047 GGGTGGTGTGGTGGAGTAGGTGG - Intronic
1008673797 6:53798261-53798283 GGGTATGGGGGAGAAGTAGGTGG - Intronic
1009001542 6:57722814-57722836 GGGAGTGAAGGAGGAGGAGAAGG - Intergenic
1009882049 6:69580728-69580750 GGGTGGGGTGGAGTGGAAGAAGG + Intergenic
1009900166 6:69800094-69800116 GGGTGAGGTGGAGGGGTGGGTGG - Intergenic
1010097914 6:72068497-72068519 GGGAGAAGTGGAGGAGTAGGGGG + Intronic
1010270995 6:73915784-73915806 GGAGGAGGTGGAGGAGGAGAAGG - Intergenic
1010452530 6:76018819-76018841 CGCTGTGTTGGAGGAGCAGAGGG - Exonic
1011420932 6:87172299-87172321 GTGTGTCTTGGAGGAGTAGTCGG - Intronic
1012055472 6:94402744-94402766 TAGTGTGGTAGAGGAGCAGAAGG + Intergenic
1013280338 6:108630347-108630369 GGGTGTTAGGTAGGAGTAGAGGG + Intronic
1013878212 6:114860610-114860632 GTGTGTGGTGGGGGTGTGGAGGG + Intergenic
1014215839 6:118751950-118751972 GGCTGAGTTGGAGGAGTTGATGG + Intergenic
1014242401 6:119032477-119032499 GGGGGTGGGGGAGGGGGAGAGGG + Intronic
1014255674 6:119158288-119158310 GGGTTGGGTGGAGGAGGAGAGGG - Intergenic
1015717415 6:136206708-136206730 GGGGGTGGTGGAGGAGGTTAGGG + Intergenic
1015720839 6:136239691-136239713 GGAAGTGGTGGAGGAGGAGGAGG + Exonic
1015999445 6:139028728-139028750 GGCTGTGGAGGAGGAGGAGCAGG - Exonic
1017041844 6:150314339-150314361 GGGGGAGGTGGAGGAGGAGGAGG + Intergenic
1017203712 6:151782831-151782853 GGATGTGGCGGAGGAATGGAAGG - Intronic
1017246901 6:152236849-152236871 GGGTCTGGTGGAGGAGAACGAGG - Exonic
1017391671 6:153946598-153946620 GGTTGTGGTGTATGATTAGAAGG - Intergenic
1017412245 6:154180533-154180555 GGGTATGGAAGAGGAGGAGAAGG - Intronic
1017429227 6:154354434-154354456 GGAGGTGGTGGTGGAGGAGATGG - Intronic
1017531713 6:155299329-155299351 GAGTGTGGTGGTAGAGTAGGTGG - Intronic
1017960538 6:159217184-159217206 GGGCGTGGTAAAGGAGGAGAGGG + Intronic
1018429717 6:163713453-163713475 GGGTGGGGGGCAGGAGAAGAGGG - Intergenic
1018851244 6:167641571-167641593 GGGGGTGGTGGTGGTGAAGATGG - Intergenic
1019096526 6:169585761-169585783 GGCTGGGGAGGAGGAGTAGCAGG + Intronic
1019511381 7:1419338-1419360 GGGCGAGGAGGAGGAGGAGACGG - Intergenic
1019666099 7:2252945-2252967 GGGTGAGGGGGAGCAGAAGAGGG - Exonic
1019829427 7:3311920-3311942 GGGTCTCATGGAGGAGTAGGAGG + Intronic
1019830277 7:3321690-3321712 GGGGGAGGAGGAGGAGGAGAAGG - Intronic
1020434996 7:8152635-8152657 GGTGGTGGTGGTGGAGGAGATGG - Intronic
1021509489 7:21420159-21420181 GGTTATGGTGGAGGGGTAGGAGG + Intergenic
1021624421 7:22578686-22578708 GGGTGGGGTGGAGGATTGGGGGG - Intronic
1021721196 7:23506237-23506259 GGGGGTGGTGGAGGAGGCGGCGG - Exonic
1022091987 7:27113877-27113899 GGGTGTGGGGGAGGGGTGGGTGG - Intronic
1022416524 7:30182438-30182460 GGGGGAGGAGGAGGAGAAGAAGG + Intergenic
1022546340 7:31192806-31192828 GTGTGTGGTGGGGGAGGAGGTGG - Intergenic
1022947814 7:35304660-35304682 GGGTGTGTTGAAGTAGAAGATGG + Intergenic
1023921289 7:44632170-44632192 GGATGTGGTGCAGGAGGAGTTGG + Intronic
1024524846 7:50339253-50339275 GTGTGTTGTGGAGGAGGAGCTGG + Intronic
1024613288 7:51085234-51085256 GGCTGTGGTGGAGGGGGAGCTGG + Exonic
1025212823 7:57030698-57030720 GGGTGTTGAGGAGGACGAGAGGG - Intergenic
1025659130 7:63546126-63546148 GGGTGTTGAGGAGGACGAGAGGG + Intergenic
1025707389 7:63880116-63880138 GAGTGTGGTAAAGGAGAAGATGG + Intergenic
1025907178 7:65796428-65796450 TGGTGTGGTGGTGGAGAAGCAGG + Intergenic
1025945178 7:66099477-66099499 GGAGGTGGAGGAGGAGGAGAAGG + Intronic
1026012409 7:66646925-66646947 GGGAGAGGTGGAGGAGGACATGG - Intronic
1026105279 7:67416124-67416146 TGGTGAGGTTGAGGAGTAAAGGG - Intergenic
1026205732 7:68255630-68255652 GGAGGTGGAGGAGGAGGAGAAGG - Intergenic
1026493652 7:70884488-70884510 GTGTATGGTGGAGGAGTACATGG + Intergenic
1027134798 7:75616579-75616601 GGGTGGGGAGGAGGAGGAGGAGG + Intronic
1027539903 7:79453662-79453684 GGGTGTGGTGGGGGTGGGGAAGG + Intergenic
1027814701 7:82953688-82953710 GGGGGTGGTGGTGGAGGAGGAGG + Exonic
1027814702 7:82953691-82953713 GGTGGTGGTGGAGGAGGAGGAGG + Exonic
1027880121 7:83823998-83824020 GGGCCTGTTGGAGGAGTAGGGGG - Intergenic
1028727826 7:94109269-94109291 GGGGGTGGAGCAGGAGGAGAAGG + Intergenic
1028796446 7:94908241-94908263 GGTTGTGGTGGAGGAGCAATAGG + Intronic
1029347569 7:99989646-99989668 AGGTGTGGGGCAGGAGGAGAGGG + Intergenic
1029364549 7:100108334-100108356 GGGTGGGGAGGAGGAATAGGAGG - Intronic
1029409526 7:100399813-100399835 GGGTGAGGTGGAGCTGGAGAGGG - Exonic
1029538332 7:101168828-101168850 GGGGGAGGGGGAGGAGAAGAGGG - Intergenic
1029675960 7:102069101-102069123 GGGTGTCGAGGAGGAGGAGAGGG - Intronic
1029708973 7:102289319-102289341 TGGTGTGGTGGAGGGGCAGGGGG + Intronic
1030005299 7:105112635-105112657 GGTGGTGGTGGAGGAGGAGGGGG - Exonic
1030198033 7:106872200-106872222 GGTTTTGTTGGAGGGGTAGAGGG - Intronic
1030340270 7:108371368-108371390 GGTTGTAGTGGCAGAGTAGAAGG - Intronic
1030685699 7:112485023-112485045 GGGTGTGGTGGAGGGGGAGGGGG + Intronic
1030810082 7:113960834-113960856 GGTTGTGGTGTGGGAGTACATGG - Intronic
1030819869 7:114083272-114083294 GGGAGTGGTGGACGAGTTCAAGG + Intergenic
1030916631 7:115322571-115322593 AGGTGTGATGAAGGAGTGGAGGG + Intergenic
1030930682 7:115520618-115520640 AGGTGTGTTGGAGGAATTGAGGG + Intergenic
1032067430 7:128782264-128782286 GGGTGTGATGGATGTGTACAGGG + Intergenic
1032231204 7:130076042-130076064 TGGTGGGGTGGAGGAGTGGGGGG + Intronic
1032946514 7:136859724-136859746 GGGTGTTGTGATGGAGTGGAGGG - Intergenic
1033275217 7:139966862-139966884 AGGGGTGGGGGAGGGGTAGAAGG - Intronic
1033330991 7:140416756-140416778 AGTTGTGGTGGAGGAGCAGGTGG + Intronic
1034432235 7:151046840-151046862 GGGTGTGGTTTAGAACTAGATGG + Intronic
1034453291 7:151149432-151149454 GGGGGTGGTGGGGAAGTTGAGGG - Intronic
1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG + Intronic
1035023389 7:155811597-155811619 GGGTGTGGTGGGGGTGAGGACGG - Intronic
1035035586 7:155892026-155892048 GGCTGTTGTGGTGGAGTTGATGG + Intergenic
1035035605 7:155892113-155892135 GGCTGTTGTGGTGGAGTTGATGG + Intergenic
1035035622 7:155892197-155892219 GGCTGTTGTGGTGGAGTTGATGG + Intergenic
1035035636 7:155892263-155892285 GGTGGTGGTGGAGGTGGAGATGG + Intergenic
1035035685 7:155892481-155892503 GGCTGTTGTGGTGGAGTTGATGG + Intergenic
1035035770 7:155892857-155892879 GGCTGTTGTGGTGGAGTTGATGG + Intergenic
1035038704 7:155911950-155911972 GGGTGTGGTGCTGGTGTAGGAGG - Intergenic
1035722018 8:1799237-1799259 GGGGGAGGAGGAGGAGAAGAAGG - Intergenic
1035856351 8:2980386-2980408 GGAGGTGGAGGAGGAGAAGAAGG - Intronic
1036056596 8:5261944-5261966 GGGTGTGATGAAGGAACAGATGG + Intergenic
1036412137 8:8512283-8512305 GGCAGTGGTGGAGGAGTGGAGGG - Intergenic
1036578876 8:10054543-10054565 GGCTGTGGAGGAGGAGGAGCTGG - Exonic
1037632676 8:20672416-20672438 GGGTGTGGAGGAGGATTTTAAGG - Intergenic
1037695740 8:21222422-21222444 GGGTGAGGTGGAGTAGGAGTGGG - Intergenic
1037781304 8:21871160-21871182 GGTTGTGATGGAGAAGTACAGGG + Intergenic
1038042628 8:23737970-23737992 GGGTGGGGAGGAGGAGGAGGAGG - Intergenic
1038240159 8:25800740-25800762 GGGTGTGCAGGAGGAGGAGTCGG - Intergenic
1038436574 8:27540738-27540760 GGCTGTGGTGGAGGAGAACTGGG - Intronic
1038548044 8:28441227-28441249 GGAAGAGGTGGAGGAGGAGAGGG - Intronic
1038558124 8:28542673-28542695 GGGTGTGGTGTGGTAGTGGATGG - Intronic
1038591987 8:28847476-28847498 GGTTGTGGTGGAGGTGGAGGTGG - Intronic
1038851045 8:31276611-31276633 GAGGATGGTGGAGGAGAAGAAGG + Intergenic
1039435923 8:37559253-37559275 GGCTGAGGTGGAGGAGGAGGAGG + Intergenic
1039457422 8:37716719-37716741 GGGGGAGGAGGAGGAGGAGAGGG + Intergenic
1040071942 8:43195674-43195696 GGGTGTGGATGAGGAGGAGGAGG + Intronic
1040073184 8:43204804-43204826 GGGTGTGGCGGACGCCTAGAGGG - Intergenic
1040802497 8:51358743-51358765 GGTTGTGGGGGAGGGGAAGAAGG - Intronic
1042183828 8:66117701-66117723 GGGTCGGGTGGAGGAGAAGTGGG + Intergenic
1042754339 8:72193658-72193680 GGGAATGGAGGAGGATTAGAAGG - Intergenic
1042987956 8:74604447-74604469 AGGTGGGGTGGAGGAGGAGGAGG + Intronic
1044300109 8:90573790-90573812 GGAGGTGGTGGAGGAGGAGGAGG - Intergenic
1044725103 8:95188293-95188315 GGGTTTGGTGGAGAAGCAGAAGG + Intergenic
1044983232 8:97736355-97736377 GGGGGAGGGGGAGGAGGAGAAGG + Intergenic
1045009241 8:97943431-97943453 GGAGGTGGAGGAGGAGGAGAAGG - Intronic
1045290703 8:100830280-100830302 GTGGGTGGTGGAGGAGTGGGGGG - Intergenic
1045403873 8:101845825-101845847 GGGAGTGGTGGGGCAGAAGAGGG - Intronic
1045459250 8:102412297-102412319 GGGTTTTGGGGAGGGGTAGAGGG - Exonic
1045471258 8:102514231-102514253 GGGAGTGGTGGGGGAATGGATGG + Intergenic
1045733962 8:105273799-105273821 GGGTGTGGTGGATTAGGAGAGGG + Intronic
1045985642 8:108246721-108246743 GGCTGAGGAGGAGGAGTAAAAGG - Intronic
1047337434 8:123950265-123950287 GGGTGAGGAGCAGGAGAAGATGG + Intronic
1047568249 8:126070027-126070049 GTGTAGGGTGTAGGAGTAGAAGG - Intergenic
1048854448 8:138674344-138674366 GTGTGTGGAGGAGGTGAAGAAGG - Intronic
1048996349 8:139795991-139796013 GGGTTTGGTGGAGGAAGAGGAGG + Intronic
1049001900 8:139831654-139831676 GGGTGGGGTGGATGACTGGATGG - Intronic
1049067970 8:140334087-140334109 GATTGTGGTGGAGAAGTAGAAGG - Intronic
1049098342 8:140561961-140561983 GGGTGTAGGGGAGCAGTTGAAGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049339275 8:142103313-142103335 GGGTGTGGTGGAAGAGTCAGGGG - Intergenic
1049609961 8:143550330-143550352 GGGTGGGGTGGAGGGGTGGTGGG - Intergenic
1049617022 8:143580059-143580081 GTGTGTGGTGGAGGACGACAAGG - Exonic
1050415991 9:5418514-5418536 GGGGGTGGCGGAGGAGGAGCAGG - Intronic
1051117725 9:13716324-13716346 GGTTGTGATGGAGGAGAAAATGG - Intergenic
1051183803 9:14438561-14438583 GGGGGTGGTGGAGGTGGAGAGGG + Intergenic
1051307630 9:15731215-15731237 GGGTGTGTTGGGGGAGGAAAGGG - Intronic
1052325383 9:27212181-27212203 GGGTTTTGAGGAGGAGTAGAAGG + Intronic
1052438391 9:28460824-28460846 GGGAGGGGTGGAGGAGTGGGAGG + Intronic
1052862052 9:33443284-33443306 GGGGGTAGTGGAGGAGGACAGGG + Intronic
1053345739 9:37376991-37377013 GGTTGTGGTGGGAGAGGAGATGG + Intergenic
1055580805 9:77704537-77704559 GGGCCTGTTGGAGGAGTAGGGGG + Intergenic
1056054390 9:82805865-82805887 GGGGAGGTTGGAGGAGTAGAAGG + Intergenic
1056578954 9:87876546-87876568 GGGTGGGGGGATGGAGTAGAAGG - Intergenic
1056771054 9:89478752-89478774 GGGTGGGGTGGAGGATGAGGGGG - Intronic
1056773155 9:89494290-89494312 GTGTGTGTTGGGGGAGGAGAGGG - Intronic
1056817410 9:89811763-89811785 GGGTGGGGAGGAGGAGGGGATGG + Intergenic
1057053809 9:91946449-91946471 GGGTGTGGAAGAGGAGGAGGAGG + Intronic
1057155645 9:92836909-92836931 GTGTGTGGTGGAGGACGACAAGG - Intergenic
1057479451 9:95433188-95433210 GGGTGTGGGGGGGGAGTGGGGGG + Intergenic
1057709831 9:97429520-97429542 GGCAGTGGTGGAGGAGGACAAGG + Intronic
1057804614 9:98211375-98211397 GTGTGTGTTGGAGGAACAGAAGG - Intronic
1057875435 9:98750177-98750199 GAGTTGGGTGGAGGAGTAGGCGG - Intronic
1058082543 9:100715136-100715158 GGGTCTAATGGAGGAGTTGAAGG - Intergenic
1058125108 9:101183491-101183513 GGATATGGTGAAGGAGTTGATGG + Intronic
1058714737 9:107713598-107713620 TGTTCTGGTGGAGGAGTAGAGGG + Intergenic
1060343199 9:122794507-122794529 GGGTGTGCTGGGAAAGTAGAGGG + Intergenic
1060776748 9:126380248-126380270 GGGAGAGGAGGAGGAGAAGAAGG - Intronic
1061007424 9:127936088-127936110 GGGTGAGGTGTAGGAGGAGGTGG - Intronic
1061227144 9:129287041-129287063 GGGTCTGGTGGTTCAGTAGAAGG + Intergenic
1061297938 9:129687041-129687063 GGGGGTGGGGGAGTAGTAAAGGG + Intronic
1061678351 9:132230738-132230760 GGGAGAGGTGGAGAAGCAGATGG - Intronic
1062326506 9:136015057-136015079 GGGAGTGGTGGGGCAGGAGACGG - Intronic
1062510328 9:136901865-136901887 GGGAGTGGGCGAGGAGAAGAGGG - Intronic
1203698619 Un_GL000214v1:118036-118058 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203699538 Un_GL000214v1:124187-124209 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203700486 Un_GL000214v1:130470-130492 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203701401 Un_GL000214v1:136490-136512 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203736850 Un_GL000216v2:144951-144973 CGGTGGCGGGGAGGAGTAGAGGG - Intergenic
1203472449 Un_GL000220v1:122108-122130 GGGGGTGGGGGGGGAGGAGAAGG - Intergenic
1203480236 Un_GL000224v1:5073-5095 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203481203 Un_GL000224v1:11401-11423 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203482167 Un_GL000224v1:17710-17732 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203548731 Un_KI270743v1:151430-151452 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
1203549686 Un_KI270743v1:156975-156997 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
1203550631 Un_KI270743v1:163140-163162 GGGCGTGGTGGGAGAGTAGCTGG - Intergenic
1203568195 Un_KI270744v1:109181-109203 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203569830 Un_KI270744v1:120424-120446 GGGCGTGGTGGGAGAGTAGCTGG + Intergenic
1203652975 Un_KI270751v1:145956-145978 GGGTGTGTTGGAGGAAGAAAAGG + Intergenic
1185755527 X:2650298-2650320 TGGTAAGGTGGATGAGTAGATGG + Intergenic
1185778378 X:2824418-2824440 GGGTGTTGGGGAGGGGTAGCTGG - Intergenic
1186191292 X:7069557-7069579 GGGTGTTGGGGAGAAGCAGATGG + Intronic
1186459955 X:9740058-9740080 GAGGGTGGGGGAGGAGAAGAGGG + Intronic
1188503440 X:30854670-30854692 GGATGGGGTGGAGTAGTTGAAGG + Exonic
1188867476 X:35331467-35331489 GGGGGTGGTGGATGAGGGGAAGG - Intergenic
1189008986 X:37027009-37027031 GTGTGTGGTGGAGGTTTGGAAGG - Intergenic
1189084490 X:38006730-38006752 GTGTGTGGTAGGGGAGTAGTGGG + Intronic
1189231047 X:39452695-39452717 GGGTGTGCTTCAGGATTAGATGG + Intergenic
1189301118 X:39953048-39953070 GGGGGTGGTGGAAGAGGAGGAGG - Intergenic
1189916745 X:45863127-45863149 GGGGGTGGTGGAGGGAGAGATGG - Intergenic
1190053946 X:47171183-47171205 GGATGAGGAGGAGGAGGAGAAGG + Exonic
1190136520 X:47804250-47804272 GGGGGTGGTGGAGGGGCAGGTGG - Intergenic
1190302743 X:49065861-49065883 GGGTGGGCTGGAGGATCAGAGGG + Intronic
1190456197 X:50629927-50629949 GGGGGTGGAGTAGGAGTGGAAGG + Intronic
1190666200 X:52697952-52697974 GGATGTGGGGGATGAGTGGAAGG + Intronic
1190673218 X:52760458-52760480 GGATGTGGGGGATGAGTGGAAGG - Intronic
1190761648 X:53442245-53442267 GGGGGTGGTGGGGGAGTAGATGG - Intergenic
1191006087 X:55712832-55712854 GGGAAAGGTGGAGGAGGAGAAGG + Intergenic
1191067197 X:56361930-56361952 GGGCGTGGTGGAGAAGAAAATGG + Intergenic
1191104778 X:56765775-56765797 GGAGGGGGAGGAGGAGTAGAAGG - Intergenic
1191672432 X:63760698-63760720 AGGTGAGGGGGAGGAGGAGAAGG + Intronic
1192169775 X:68847061-68847083 GGGTGGGGTGGGGGATGAGAGGG - Intergenic
1192182833 X:68927062-68927084 GGATGTTGAGGAGGAGCAGAGGG + Intergenic
1192211513 X:69130836-69130858 AGGGGTGGTGGTGGGGTAGAAGG - Intergenic
1192491231 X:71578866-71578888 GGGCCTGGTGGTGGCGTAGAAGG + Intronic
1192805398 X:74504376-74504398 GGGAGTGGTAGAGTAGCAGAAGG - Intronic
1192821028 X:74645721-74645743 GGCTGTGGGGGAGGAGTGGATGG - Intergenic
1193648111 X:84093177-84093199 GGGAGTGGTGGGTGAGGAGATGG + Intronic
1194709703 X:97220494-97220516 TGGGGTGGTGGGGGAGCAGATGG - Intronic
1195363426 X:104106433-104106455 GGGTGTGGGGCAGGAGGACAGGG + Intronic
1195455080 X:105059251-105059273 GGGTGGGGTGGAAGTGGAGATGG - Intronic
1195626152 X:107007102-107007124 GGGGGTGGTAGTGGAGCAGAGGG - Intergenic
1195636702 X:107125105-107125127 GGGTGAGGAGGAAGAGGAGAGGG - Intronic
1196947395 X:120841344-120841366 GGGTGGGAGGGAGGAGTTGAAGG + Intergenic
1197782478 X:130171844-130171866 GGGTGCGCTGGAGGAGGAGGAGG + Exonic
1198467505 X:136916890-136916912 GGGGGAGGAGGAGGAGGAGAAGG - Intergenic
1199612694 X:149631604-149631626 GGGTGCGGGGGAGGAGGAGGAGG - Exonic
1200009146 X:153108401-153108423 GGGTGGGGGGCAGGAGAAGAAGG - Intergenic
1200030454 X:153291521-153291543 GGGTGGGGGGCAGGAGAAGAAGG + Intergenic
1200107956 X:153724921-153724943 GGGGGAGGAGGAGGAGGAGAAGG + Exonic
1200160365 X:154004667-154004689 TGGTGTGGAGGAGGAGGAGGAGG + Intergenic
1201291560 Y:12425312-12425334 GGGTGTTGGGGAGGGGTAGCTGG + Intergenic
1201894922 Y:18982937-18982959 GGAAGAGGTGGAAGAGTAGAAGG + Intergenic