ID: 918036444

View in Genome Browser
Species Human (GRCh38)
Location 1:180877732-180877754
Sequence ATGCTTATCTTAAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1217
Summary {0: 1, 1: 1, 2: 17, 3: 131, 4: 1067}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918036444 Original CRISPR ATGCTTATCTTAAAAAAAAA AGG Intronic
901418011 1:9130012-9130034 ATGCTTATTTTAAGAAAAGGTGG - Intergenic
901620224 1:10579148-10579170 CTGCTAATATTAAATAAAAAGGG + Intronic
902068577 1:13711993-13712015 ATCTTTTTCTTAATAAAAAAAGG - Intronic
902900908 1:19515263-19515285 AGACTTGTCTCAAAAAAAAAAGG + Intergenic
904064646 1:27739830-27739852 ATGATAATGTTAAAAAAAATAGG + Intronic
904117453 1:28173279-28173301 CTGTGTCTCTTAAAAAAAAAGGG + Intronic
904512293 1:31022163-31022185 CTGCTCATCTAAAAAAAAATGGG + Intronic
905288554 1:36904980-36905002 ATGGTTCTCTTAAAAACACAAGG + Intronic
905998628 1:42404037-42404059 ATGAGTCTCTAAAAAAAAAATGG - Intronic
906068711 1:43001840-43001862 ATGAGTGCCTTAAAAAAAAAAGG - Intergenic
906466921 1:46090117-46090139 ATTTTTATCTTAAAACAATATGG - Intronic
906621240 1:47281795-47281817 ATTCTTATTTTAGAAGAAAAAGG - Intronic
906809897 1:48815535-48815557 TTCCTTATCTAAAAAAAAATAGG + Intronic
907754213 1:57294464-57294486 ATGCTTTGTTTAAAAAAAAAAGG - Intronic
907801872 1:57775377-57775399 ATACTTATATTAGAAAAATAGGG - Intronic
908455547 1:64300831-64300853 ATGCATATATTAGAAATAAAGGG + Intergenic
908683382 1:66687445-66687467 AGTCTTCTCTTAAAAAAAAAAGG - Intronic
908758003 1:67486535-67486557 CTGCTTGTCCTAAAATAAAAGGG - Intergenic
908796635 1:67836390-67836412 CTGCTTGTCTTTAAAATAAAGGG + Intergenic
909048812 1:70744009-70744031 ATATTAATCTTAAAAATAAATGG - Intergenic
909241160 1:73215562-73215584 ATTCTTATTTTATAAAACAAGGG - Intergenic
909338395 1:74503581-74503603 ATAGCTATCCTAAAAAAAAATGG - Intronic
909362187 1:74774961-74774983 ATACTTATGTTAAAAATAAGAGG - Intergenic
909591870 1:77359527-77359549 TTGATAATCTGAAAAAAAAATGG + Intronic
909624942 1:77705107-77705129 ATGCTTTGTTTAAAAAAAAAAGG + Intronic
909638330 1:77843292-77843314 ATCTTTATCTTAAAAGTAAAAGG - Exonic
909763301 1:79321463-79321485 GTGCTTTTCTTATAAGAAAAGGG - Intergenic
909966783 1:81922688-81922710 ATGCTGGTTTTAAAAAAAAGTGG - Intronic
909972156 1:82003909-82003931 ATCCTTATTTTACAAAAGAAGGG + Intergenic
910302866 1:85727370-85727392 ATGGCTATTTTAAAAATAAAAGG - Intergenic
910425121 1:87113947-87113969 CTCTTTCTCTTAAAAAAAAAGGG - Intronic
910913661 1:92265346-92265368 ATGACTAGCTTAAGAAAAAAAGG + Intronic
911544849 1:99203676-99203698 CTGCCTCTCTTAAAAAAGAAAGG + Intergenic
911755962 1:101557136-101557158 AATTTTATTTTAAAAAAAAAGGG - Intergenic
911824144 1:102460180-102460202 AAGCTTATTTAAAAAAATAATGG - Intergenic
911935589 1:103966279-103966301 AACGCTATCTTAAAAAAAAAAGG - Intergenic
912073710 1:105846131-105846153 ATTTTTTTCTTAAAAGAAAATGG + Intergenic
912240152 1:107898093-107898115 ATTATTAAATTAAAAAAAAAAGG + Intronic
912724321 1:112045256-112045278 TTTCTTCTTTTAAAAAAAAAGGG + Intergenic
913197005 1:116465510-116465532 ATTCTTATCAATAAAAAAAATGG - Intergenic
913310096 1:117481311-117481333 AAGCCTATTTAAAAAAAAAAAGG + Intronic
913942524 1:125121116-125121138 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
914507322 1:148301238-148301260 GTGTTTACCTGAAAAAAAAAAGG + Intergenic
914619732 1:149393656-149393678 ATTCTTCTCTTAAACAAAATCGG + Intergenic
915029632 1:152866974-152866996 ATGCTCATCTTAAAAAAAATCGG - Intergenic
915652646 1:157329003-157329025 ATCCTTAATTTAAATAAAAAAGG - Intergenic
915873325 1:159585423-159585445 ATCATTATCTTAACAAAAAATGG - Intergenic
916635670 1:166665785-166665807 ATGATTATGCTAAAATAAAAGGG + Intergenic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
916998846 1:170332767-170332789 ATGTTTATCTTTCAAAGAAATGG + Intergenic
917128768 1:171717617-171717639 CCCCTTCTCTTAAAAAAAAAAGG - Intronic
917433008 1:174990327-174990349 ATTTTTATCTTACATAAAAATGG + Intronic
917587379 1:176441237-176441259 TTGTTTATCTTTAAAATAAAGGG + Intergenic
917766302 1:178221373-178221395 ATGCATATCTTAAAAAAAGAAGG - Intronic
917783164 1:178421876-178421898 ATGATTACCTTAAAACAAAGAGG - Intronic
917912027 1:179658869-179658891 ATGCTTATATTAGAAAAGAAAGG - Intronic
918036444 1:180877732-180877754 ATGCTTATCTTAAAAAAAAAAGG + Intronic
918304814 1:183236217-183236239 TTGCTTTTGTTAAAAAAAAAGGG + Intronic
918444146 1:184599728-184599750 ATGCTTCTCTTTACTAAAAAAGG - Intronic
918588559 1:186215872-186215894 ATGCTGATCATAAAAGAACAAGG + Intergenic
918703519 1:187634782-187634804 ATGCTACATTTAAAAAAAAATGG - Intergenic
918884491 1:190173801-190173823 ATGCTAATCTCACAAAAAATTGG - Intronic
919023633 1:192140218-192140240 ATGCTTATTTTCCAAAGAAAAGG - Intergenic
919243734 1:194949992-194950014 ATGCCTATATTAAAAAAGATAGG + Intergenic
919868424 1:201801734-201801756 ATAATTATTTTAAAATAAAAAGG + Intronic
920332715 1:205222370-205222392 CTGATAAGCTTAAAAAAAAAAGG + Intergenic
920539050 1:206763637-206763659 ATGCTTTTCTTAGAGAATAAAGG + Intergenic
921089419 1:211829868-211829890 TTTTTTTTCTTAAAAAAAAAAGG - Intronic
921117676 1:212109487-212109509 TTCCTTATCTGAAAAAAAAATGG - Intergenic
921248206 1:213269695-213269717 ATGCCTATATCAGAAAAAAAGGG + Intronic
921330158 1:214027388-214027410 ATGCTTGACTTTAAAAAAGAAGG - Intronic
921691892 1:218161237-218161259 ATGGTTAACGTAAAACAAAATGG + Intergenic
921874957 1:220184889-220184911 ATGTATCTGTTAAAAAAAAAAGG + Intronic
921978794 1:221232224-221232246 ATTCTTCTATTAAAAAAAAATGG - Intergenic
922009410 1:221566631-221566653 ATGTTTATTCCAAAAAAAAATGG + Intergenic
923125839 1:231033669-231033691 ATGCTTACCTTTAAACAAAAGGG + Intronic
923136733 1:231126523-231126545 ATCTTTAAATTAAAAAAAAAAGG - Intergenic
923446457 1:234076289-234076311 AAGCATATTTTAAAAGAAAAAGG + Intronic
923637815 1:235718655-235718677 ATGTTTAGTTTAAAGAAAAATGG - Intronic
923639211 1:235736527-235736549 ATGATTATCTTGAAAAGAAGAGG + Intronic
923669403 1:236027242-236027264 ATGCTTTTTTTTAAAAAAACAGG - Intronic
923987580 1:239398837-239398859 ATGCTTATATTAAAACTGAAAGG - Intronic
924013595 1:239694729-239694751 TTGTTTATCTTAAAATACAAAGG - Intronic
924353538 1:243144948-243144970 ATGCATTACTTAAGAAAAAATGG + Intronic
924662457 1:246033951-246033973 ATAATTATCTCAAAAATAAAAGG + Intronic
1063245120 10:4209658-4209680 ATTCTTCAATTAAAAAAAAACGG + Intergenic
1063397977 10:5709789-5709811 ATGATTATTTTAAAAAATATAGG - Intronic
1064259172 10:13771083-13771105 ACTCATCTCTTAAAAAAAAATGG - Intronic
1064615466 10:17150447-17150469 ATTCCTTTCTTAAAACAAAAAGG + Intronic
1064857142 10:19782117-19782139 ATGCTTAGCTTTAATACAAAAGG + Intronic
1065040303 10:21687315-21687337 ATGCTTCCCTGAAATAAAAAAGG - Intronic
1065045735 10:21746516-21746538 CCTCTTCTCTTAAAAAAAAAAGG + Intergenic
1065111776 10:22447432-22447454 ATATTTATCATAAAAAACAAAGG - Intronic
1065213686 10:23429512-23429534 ATACTGACTTTAAAAAAAAAGGG - Intergenic
1065622801 10:27600370-27600392 ATGCTTATGATAAAGGAAAATGG - Intergenic
1065673557 10:28149198-28149220 TAGCTTGTCTTAAAAAATAAAGG + Intronic
1066209719 10:33224843-33224865 GCGCTTATTTTAAAAAGAAATGG + Intronic
1066242880 10:33554964-33554986 ATAATTCTGTTAAAAAAAAAAGG - Intergenic
1066517168 10:36175779-36175801 ATGGCTATGTTAAAAAAAATTGG + Intergenic
1066818950 10:39458451-39458473 TTGCATATCTTACAAAAAGAGGG + Intergenic
1067066711 10:43108021-43108043 CTGGGTAACTTAAAAAAAAAAGG + Intronic
1067168993 10:43889702-43889724 ATGCCTATATTAGAAAAGAAAGG - Intergenic
1067669775 10:48307746-48307768 ATGCTTATCTCAAAACACAATGG - Intronic
1067803691 10:49378241-49378263 AAGGGTATCTTTAAAAAAAAAGG + Intronic
1067892405 10:50148365-50148387 ATACGTATCTCTAAAAAAAAGGG - Intergenic
1068004661 10:51378758-51378780 TTTCTCATCTGAAAAAAAAATGG + Intronic
1068033437 10:51731356-51731378 ATTCTTAAATTTAAAAAAAATGG + Intronic
1068187453 10:53604517-53604539 AAACTTATTTTAAAAAATAATGG - Intergenic
1068205928 10:53853208-53853230 ATCCATATGTAAAAAAAAAAAGG + Intronic
1068883400 10:62074335-62074357 ATGCTTATGGTAAAAGCAAAAGG - Intronic
1068999216 10:63244798-63244820 CTCCTTCTCTTAAAAAAAAAGGG + Intronic
1069021660 10:63495262-63495284 GGGATTATCTCAAAAAAAAAAGG + Intergenic
1069031746 10:63603349-63603371 ATGCTTATTTTAATAATGAAGGG - Intronic
1069341831 10:67419299-67419321 ATCCTTGTCTTAAAACCAAAAGG + Intronic
1070311146 10:75275134-75275156 ATCCTTTTCTGGAAAAAAAAAGG - Intergenic
1071045229 10:81365932-81365954 AAGGTTATTTTAAAAAATAATGG - Intergenic
1071062431 10:81588550-81588572 ATGAGTTTCTTAGAAAAAAATGG - Intergenic
1071207841 10:83302572-83302594 ATGTCTAACTTAAGAAAAAATGG + Intergenic
1071549329 10:86554356-86554378 CTGCTTAACTTAAGCAAAAATGG + Intergenic
1071726817 10:88206818-88206840 ATCTTTTTCTTACAAAAAAAAGG - Intergenic
1071902252 10:90133394-90133416 ATGCTTATCTTTTCCAAAAATGG - Intergenic
1071905570 10:90169911-90169933 ATATTTATCTTAAAAGAAATGGG - Intergenic
1072430704 10:95368459-95368481 ATGCTTGTTTTTAAAAATAAGGG + Intronic
1072459543 10:95606549-95606571 TTTCTTACTTTAAAAAAAAAGGG + Exonic
1072858722 10:98979402-98979424 ATGCTTATTTTTTAAAAAATAGG - Intronic
1072886669 10:99282880-99282902 ATGCCTACGTTAAAAAAAGAAGG + Intergenic
1073304269 10:102490686-102490708 TTTCTTTTCTTAAATAAAAATGG - Intronic
1073316489 10:102584728-102584750 TTGTTTAGGTTAAAAAAAAAAGG + Intronic
1073348824 10:102804408-102804430 ATTTTTTTTTTAAAAAAAAAAGG - Intronic
1073857182 10:107690889-107690911 AAGCATATCTCAAAACAAAAAGG - Intergenic
1073952530 10:108827612-108827634 ATGATTACATTAAATAAAAATGG + Intergenic
1075141799 10:119844365-119844387 ATGCTTGTATTAAAAAATACAGG - Intronic
1075207469 10:120459460-120459482 ACGCTTATCTGAGAAAACAAAGG - Intronic
1075212730 10:120504762-120504784 AGGCTTATCCTAAAAAGAGAGGG - Intronic
1075436622 10:122449032-122449054 ATGTTTATCAAAAACAAAAAGGG - Intergenic
1076018499 10:127049712-127049734 ATGCTTTTGTGAAAAAAAAATGG + Intronic
1076172109 10:128327784-128327806 TTGCTTATCTTTATAAAGAAAGG - Intergenic
1076239609 10:128894452-128894474 GTGTTTATCTGAAAAAATAATGG + Intergenic
1076628434 10:131836816-131836838 ATAATTATATTAAAATAAAATGG + Intergenic
1076641875 10:131922757-131922779 ATTTTTTTCTTAAAAAAAATTGG + Intronic
1077758647 11:5065527-5065549 ATTCCTATTTTAAAAAAAACTGG - Intergenic
1078213594 11:9292007-9292029 ATATTTATGTTAAAAAGAAAAGG - Intronic
1078239928 11:9522129-9522151 ATGCTTGTATTGGAAAAAAAAGG + Intronic
1078712581 11:13809051-13809073 ATGCACATATTAAAAAAATATGG + Intergenic
1078721887 11:13892508-13892530 AAGTTTATTTTAAAAAAAAAAGG - Intergenic
1078806507 11:14710830-14710852 ATGCTTTTTTTAAAAAAATGTGG + Intronic
1078813016 11:14789759-14789781 ATGCTAATCTTATAAATGAAAGG + Intronic
1079198037 11:18347817-18347839 GTGCTTCTCTTAAAATAAAGGGG - Exonic
1079285760 11:19130658-19130680 ATGCTTATATTACCAAAAAAAGG - Intronic
1079568312 11:21910619-21910641 ATGCTTAACTTAAAAGGAAAGGG - Intergenic
1079648468 11:22896312-22896334 ATGGTCATCTTAGAAAAATAGGG + Intergenic
1079720076 11:23799910-23799932 ATAGTTGCCTTAAAAAAAAAAGG + Intergenic
1079809378 11:24977131-24977153 ATGTTTATATTAATAATAAATGG + Intronic
1080685000 11:34507996-34508018 ATATTTATGTTAAAACAAAAAGG - Intronic
1080732420 11:34972317-34972339 ATGCTTATATTAAAAAATAAAGG - Intronic
1080869584 11:36225700-36225722 TTCTTCATCTTAAAAAAAAAAGG + Intronic
1080901025 11:36491150-36491172 ATTCTTGACTTTAAAAAAAATGG - Intronic
1081174104 11:39904627-39904649 ATGCCTAGGTTAAAAAAAACAGG + Intergenic
1081432027 11:42986753-42986775 ATGCATATGTTTAAAAAATAGGG - Intergenic
1081533517 11:43981470-43981492 AAGTTTATCTTTTAAAAAAAGGG + Intergenic
1082779178 11:57273081-57273103 ATGCTAATGTTGAAAAAACATGG - Intergenic
1082917309 11:58451186-58451208 AAGTATATATTAAAAAAAAAAGG + Intergenic
1083967861 11:66053674-66053696 TTGCTTCTTTAAAAAAAAAAGGG + Intronic
1084913549 11:72410367-72410389 CTGCATCTGTTAAAAAAAAATGG + Intronic
1084994487 11:72962600-72962622 ATTCTTAGTTTAAAAAAAAAAGG - Intronic
1085797838 11:79559699-79559721 ATACTTATGTTTAAAAGAAAGGG + Intergenic
1085826119 11:79849495-79849517 ATGTTTACCTTAAAGAAAAAAGG + Intergenic
1086747698 11:90451019-90451041 ATGCTTCTCTTGTAAAGAAATGG + Intergenic
1086824647 11:91481513-91481535 ATGCTTATCTTTAAAATGGAGGG - Intergenic
1086972035 11:93092067-93092089 ATGCTTAAATTTAAAAAAATAGG - Intergenic
1087025848 11:93648962-93648984 ATGCTAAACTGAAAAAAAAATGG + Intergenic
1087039956 11:93788912-93788934 ATCCATCCCTTAAAAAAAAAGGG - Intronic
1087169410 11:95036125-95036147 CTGATAATGTTAAAAAAAAAAGG - Intergenic
1087613661 11:100464048-100464070 AAGCATATCTTAAAGAAAATAGG - Intergenic
1087684406 11:101246836-101246858 CTGTTTTTTTTAAAAAAAAAAGG + Intergenic
1088323143 11:108573787-108573809 ATTCTCATCTTAAAAACAAAAGG + Intronic
1088597773 11:111452647-111452669 ATGCTTATCATAAACAGGAATGG - Intronic
1088698701 11:112392491-112392513 CTGCTTATTTAAAAATAAAATGG + Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089347636 11:117800899-117800921 ATACTTTTCTTCAAAAACAAAGG + Intronic
1089972268 11:122703714-122703736 ATGCTTGTCTTCAAAAAACAAGG - Intronic
1091196731 11:133737984-133738006 ATACATATTTTAAAAAAAGAGGG + Intergenic
1091689692 12:2587594-2587616 ATGTTAATTTTAAAAAAAAAGGG + Intronic
1092355639 12:7792660-7792682 ATCCTAATTTTAAAAAAAAGGGG + Intronic
1092679238 12:10959163-10959185 ATGCTTAGACTAAAAAAAAATGG - Intronic
1092703992 12:11264434-11264456 ATGTGTGTTTTAAAAAAAAATGG + Intergenic
1093221734 12:16429049-16429071 ATTGTTATCTTAAAAAGCAAAGG - Intronic
1093376219 12:18430943-18430965 AAGATTATTTAAAAAAAAAATGG - Intronic
1093796018 12:23312077-23312099 ATAGTTATATTAAAAATAAAAGG + Intergenic
1093915660 12:24799835-24799857 ATGTTTTTCAAAAAAAAAAAAGG - Intergenic
1094222482 12:28009206-28009228 TTGCTTCTCTTACAAAAGAAAGG - Intergenic
1094256419 12:28433044-28433066 AGGCCTGACTTAAAAAAAAATGG - Intronic
1094264908 12:28546178-28546200 TTACTTACCTTAAAAAGAAATGG + Intronic
1094269236 12:28592888-28592910 ATGCTTATTTAAAGAAATAATGG + Intergenic
1094353791 12:29556051-29556073 CTTCTAAACTTAAAAAAAAAAGG - Intronic
1095269609 12:40202352-40202374 ATGCTTTTTTTTAAAAAAAAAGG + Intronic
1095495770 12:42782051-42782073 AGGCTTATCTTTTAGAAAAATGG - Intergenic
1095503398 12:42865818-42865840 TAATTTATCTTAAAAAAAAAAGG + Intergenic
1095638622 12:44460530-44460552 ATCCTTTTCTTTAAAAAGAAAGG - Intergenic
1095695654 12:45141314-45141336 ATAATTATCTTAAAAATAAAAGG + Intergenic
1095940136 12:47721294-47721316 AGATTTATCTTGAAAAAAAAAGG - Intronic
1096106897 12:49001335-49001357 AAGCTTATTTTAAAAAAAGAAGG - Intergenic
1096218914 12:49815522-49815544 AGACTTGTCTTAAAAAGAAAAGG - Intronic
1096249965 12:50024781-50024803 ATGCTTTCTTAAAAAAAAAAAGG + Intronic
1096341937 12:50808222-50808244 TTGCTTATTTTAACAAAAAGAGG - Intronic
1096841542 12:54382831-54382853 ATATTTTTTTTAAAAAAAAAAGG - Intronic
1097313779 12:58150552-58150574 AGGCCTGGCTTAAAAAAAAAGGG - Intergenic
1097453013 12:59758772-59758794 AGACTTATCTTAAAACAAAGTGG - Intronic
1097651575 12:62304825-62304847 ATGCTTAAAAAAAAAAAAAAAGG + Intronic
1097751482 12:63359078-63359100 AGCTTCATCTTAAAAAAAAACGG + Intergenic
1097862822 12:64535073-64535095 ACGTTTATATGAAAAAAAAAAGG + Intergenic
1097970747 12:65630420-65630442 TTGCTTATCTTTTAAAAGAAAGG - Intergenic
1098197316 12:68015665-68015687 ATGTTTATAGTAAAAATAAAAGG + Intergenic
1098276674 12:68819266-68819288 ATCCTTAGTTTAAAAACAAAAGG + Intronic
1098653126 12:73000049-73000071 AGGCTTTTCCTTAAAAAAAATGG + Intergenic
1098659963 12:73080119-73080141 ATGTTTTTCCTACAAAAAAATGG + Intergenic
1099090162 12:78296662-78296684 ATAATTATGTTAATAAAAAAGGG + Intergenic
1099259319 12:80357302-80357324 ATGATGATCTCAAAAAAGAATGG + Intronic
1099261243 12:80385497-80385519 GTGCTTATCTTATATAAGAAAGG + Intergenic
1099406141 12:82265703-82265725 AAGCTTATATAAAAAAAAATTGG - Intronic
1100141939 12:91629935-91629957 ATGGTTATTTAAGAAAAAAAAGG - Intergenic
1100168989 12:91951353-91951375 ATGCTTATCCAAAATAAATAAGG - Intergenic
1100418948 12:94410431-94410453 ATGTTTATAATGAAAAAAAAGGG - Intronic
1100543725 12:95581588-95581610 ATGCTTTTCTCAAAGAAATAGGG + Intergenic
1100543842 12:95582969-95582991 ATGCTTTTCTCAAATAAATAGGG + Intergenic
1100546753 12:95610528-95610550 ATTTTTATTTTAAAAGAAAAGGG - Intergenic
1100631833 12:96398135-96398157 ATGGTTGGCTTAAAAAAAAACGG - Intronic
1100751206 12:97699851-97699873 TTGTTTTTTTTAAAAAAAAAAGG - Intergenic
1101073071 12:101096851-101096873 CTGCTTATCTTAGCAACAAAAGG - Intronic
1101322127 12:103681884-103681906 ATCCTTATATTAATAAAAAGGGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101394137 12:104329305-104329327 GTGGTTTCCTTAAAAAAAAAAGG + Intronic
1102123546 12:110462220-110462242 ATGCTTTTCTTTGAGAAAAAAGG - Intronic
1102313949 12:111871065-111871087 ATCCTGAAATTAAAAAAAAAAGG - Exonic
1102731142 12:115111144-115111166 GTTCTTCTCTTAAACAAAAAAGG - Intergenic
1103380884 12:120493536-120493558 ATACTTATTTAAAAAATAAAGGG + Intronic
1103758052 12:123225606-123225628 ATGCTAATGTCAAAAAAAAAAGG + Intronic
1104765775 12:131329293-131329315 ATGCTAAAATTAACAAAAAAAGG + Intergenic
1105538429 13:21292417-21292439 CTGCTCATCTTAGAAAATAAGGG - Intergenic
1106034931 13:26035297-26035319 ATGCTTAGTTTAAATAAATATGG + Intergenic
1106151124 13:27103400-27103422 ATGCTTTTCTATTAAAAAAATGG + Intronic
1106264089 13:28094403-28094425 CTGTTTAACCTAAAAAAAAATGG + Intronic
1106455083 13:29919845-29919867 AACCTTATCTTAAAAAAAAAAGG + Intergenic
1106617162 13:31340292-31340314 CTGCTTGTCTCAAAAAGAAAAGG + Intergenic
1106958210 13:34967347-34967369 TTGCTTTTTTAAAAAAAAAAAGG - Intronic
1107029004 13:35831989-35832011 ATGCTTGTCAAAAAAAGAAATGG + Intronic
1107072726 13:36288890-36288912 ATTCTTATCCTAAAATAAAATGG + Intronic
1107123215 13:36818056-36818078 AAGATTATATTAAAAACAAAGGG - Intergenic
1107532558 13:41298025-41298047 CTCCTTCTCTCAAAAAAAAAGGG - Intergenic
1108064446 13:46563348-46563370 AAGCTATACTTAAAAAAAAAAGG - Intronic
1108423575 13:50275084-50275106 ATGCCTATTTAAAAAAAAGAGGG - Intronic
1108808762 13:54193732-54193754 ATGCTTATACTCAAAAAAATGGG + Intergenic
1108828450 13:54446768-54446790 ATTCTCATCTGACAAAAAAATGG - Intergenic
1108997424 13:56751800-56751822 ATATTTCTCTTAAAAAAAATCGG - Intergenic
1109121697 13:58465988-58466010 TGGCTTATCTGCAAAAAAAAGGG - Intergenic
1109410418 13:61958409-61958431 ATGATTATCTTACAGAAAGAGGG + Intergenic
1109559798 13:64031932-64031954 ATGCTTTGCTTTAAAAAAAAAGG + Intergenic
1109631414 13:65053478-65053500 ATGCTTATATAATAAAATAAAGG - Intergenic
1109730629 13:66408728-66408750 ATTATTATTTGAAAAAAAAAAGG - Intronic
1110307028 13:74000062-74000084 ATTCTTAGCTTTAAAAAAAGTGG - Intronic
1110323919 13:74192156-74192178 ACTATTAACTTAAAAAAAAATGG + Intergenic
1110487534 13:76064831-76064853 ATGCATAAATTAAAAATAAAAGG - Intergenic
1110551710 13:76818177-76818199 GTGCCAATATTAAAAAAAAAAGG - Intergenic
1110607371 13:77448428-77448450 TTTCTTATCTCAAAAAAGAAAGG + Intergenic
1110730202 13:78871607-78871629 AGGCTTATCTAAAAATAACATGG + Intergenic
1110807779 13:79777739-79777761 ATCCTTATCTTTAAAGATAAGGG + Intergenic
1111146746 13:84191748-84191770 ATGCTTTTTTTAAAGGAAAAGGG - Intergenic
1111503544 13:89157423-89157445 ATACTAGTTTTAAAAAAAAATGG + Intergenic
1111826884 13:93279069-93279091 ATAATTATCTTAGAAAGAAAAGG - Intronic
1112112334 13:96315678-96315700 GTCCTTTTTTTAAAAAAAAATGG - Intronic
1112150701 13:96759278-96759300 ATAATTATGTTAAAAATAAATGG - Intronic
1112215663 13:97429288-97429310 ATGTTTATATTATAAAATAATGG - Intergenic
1112503978 13:99963664-99963686 ATGGTTTATTTAAAAAAAAAAGG - Exonic
1112634121 13:101196158-101196180 AAGATTGTATTAAAAAAAAATGG - Intronic
1112670470 13:101630247-101630269 ATACTTATTTTAAATAACAAAGG - Intronic
1112762294 13:102705007-102705029 ATTCTTTTTTTTAAAAAAAAAGG - Intergenic
1113141234 13:107152541-107152563 TTGGGTAACTTAAAAAAAAATGG - Intergenic
1114922560 14:27351215-27351237 ATGCTTTTCTTAAAAACTATGGG + Intergenic
1114954664 14:27803189-27803211 ATGCTGATGTTAAAAGATAATGG + Intergenic
1114965107 14:27948783-27948805 ATACTAATTTTAAAACAAAAAGG + Intergenic
1115184848 14:30674775-30674797 ATGCTTATTTTAAAATAATCTGG - Intronic
1115340052 14:32283835-32283857 ATGCTTCTAATAAAAAAATAGGG + Intergenic
1115454344 14:33584392-33584414 ATGTTTATTTAAAAAAAAAAAGG + Intronic
1115650839 14:35402215-35402237 ATGCTTCTCTTTAAAAAAAGAGG + Intronic
1115691759 14:35851411-35851433 ATGCTACTCTTTAAAAAAGAGGG + Intronic
1115782873 14:36789396-36789418 ATGGTTTTCTTAGAAAGAAATGG - Intronic
1115867393 14:37762152-37762174 AGCCTTTTCTTAAAAAAAAAGGG - Intronic
1115994534 14:39182461-39182483 ATGCTTAGATTAAAATAACAAGG - Exonic
1116250429 14:42474889-42474911 ATGCTTACATAAAAAATAAATGG - Intergenic
1116486004 14:45449335-45449357 AAACTATTCTTAAAAAAAAATGG - Intergenic
1116611364 14:47076951-47076973 ATGATTATCTTATTAAAAAATGG - Intronic
1116652219 14:47607948-47607970 AAGTTTATCAGAAAAAAAAATGG - Intronic
1116822630 14:49640337-49640359 AAGCTATCCTTAAAAAAAAATGG + Intergenic
1116964929 14:51004259-51004281 ATTCTTCTCTTAAAATACAAGGG + Intronic
1117394545 14:55296110-55296132 TTGGTTAACTTTAAAAAAAAGGG - Intronic
1117743909 14:58847881-58847903 TTCCATCTCTTAAAAAAAAAAGG + Intergenic
1117813454 14:59573169-59573191 ATGCTTAGGTATAAAAAAAATGG + Intronic
1117837572 14:59823273-59823295 ATGATGATTTAAAAAAAAAAGGG - Intronic
1117989875 14:61422790-61422812 CTGCTTCTTTTAAAAAAAATGGG - Intronic
1118178447 14:63466125-63466147 ATGTTAATCTTCAAAACAAATGG - Intronic
1118520425 14:66576586-66576608 ATACTTATCTTAAAAATTTATGG + Intronic
1118576648 14:67248345-67248367 TCTCTTTTCTTAAAAAAAAAAGG + Intronic
1118952174 14:70445017-70445039 GTGCTTATCTTAACTAAAAGTGG - Intergenic
1119284941 14:73445727-73445749 TTTCTTATCTTCAAAATAAATGG - Intronic
1119733968 14:76969296-76969318 AAGCTGAACTTAAAAAGAAAAGG + Intergenic
1120025132 14:79574942-79574964 ATTCTTGCTTTAAAAAAAAATGG + Intronic
1120086717 14:80283988-80284010 ATGCTTACCACAATAAAAAAAGG - Intronic
1120343519 14:83253518-83253540 ATGATTTCTTTAAAAAAAAAAGG - Intergenic
1120657118 14:87204426-87204448 AAGCTTTTCTTAAAGTAAAATGG + Intergenic
1120729514 14:87986788-87986810 ATGCTTAAGATAATAAAAAAAGG - Intronic
1120831260 14:88999748-88999770 AGGCTTTCATTAAAAAAAAAAGG - Intergenic
1121875713 14:97449544-97449566 ATGAATATCTCAAAAAAAATGGG - Intergenic
1122449667 14:101795511-101795533 ATAAGTATCTTAAAAAAAAAAGG - Intronic
1122650412 14:103223126-103223148 AAGATTATCTTCCAAAAAAATGG - Intergenic
1122996192 14:105266143-105266165 GTGCTTATGTTAGAAAAAACAGG + Intronic
1124499981 15:30219461-30219483 ATGCCTAGCTTAAAAAGAAATGG - Intergenic
1124559443 15:30758170-30758192 AGGCTTCACTTAAAAAAAATGGG + Intronic
1124671807 15:31647551-31647573 AGGCTTCACTTAAAAAAAATAGG - Intronic
1124743596 15:32319205-32319227 ATGCCTAGCTTAAAAAGAAATGG + Intergenic
1124893059 15:33750427-33750449 CTGCTTATATCAAAAAAAGAGGG - Intronic
1124972133 15:34497660-34497682 ATCCTCATCTTAAAAGTAAATGG + Intergenic
1125888448 15:43247508-43247530 AAGCTGACCTCAAAAAAAAAAGG + Intronic
1126330738 15:47528356-47528378 TTGGTTACCTTAAAAAAAATTGG - Intronic
1126420022 15:48462350-48462372 TTATTTGTCTTAAAAAAAAAAGG - Intronic
1127070700 15:55286054-55286076 TTGCTTCTCTTAGAAAAAAATGG + Intronic
1127262107 15:57334193-57334215 ATGCTTCTTTTAAAAAAATGTGG + Intergenic
1127266285 15:57364993-57365015 AGGCTAGTCTTAAAAGAAAAAGG + Intergenic
1127672839 15:61212248-61212270 TTGTTTGTTTTAAAAAAAAAAGG + Intronic
1127691474 15:61401527-61401549 ATGCTTATTGTAGAAAAAATCGG + Intergenic
1127778091 15:62284477-62284499 ATGTTTTTTTTAAAAAAAAAGGG - Intergenic
1127986479 15:64076009-64076031 ATCCTTCTCTAAAAAAAAAAAGG + Intronic
1128488056 15:68116686-68116708 ATGCCTATATTAGAAAAAAAAGG - Intronic
1128823390 15:70683830-70683852 ATGTTTTTTTTAAAAAAAACAGG - Intronic
1128956969 15:71957484-71957506 AAACTTTTGTTAAAAAAAAAAGG - Intronic
1129427134 15:75471933-75471955 ACTCTTGTCTCAAAAAAAAAAGG + Intronic
1130212786 15:81941101-81941123 ATGTTTTTTTTAAAAAAAAAAGG + Intergenic
1130406057 15:83603008-83603030 AAGACTATCTCAAAAAAAAAAGG - Intronic
1130751340 15:86716289-86716311 ATGCTAACTTAAAAAAAAAAAGG - Intronic
1131383881 15:91986468-91986490 CTGCATACTTTAAAAAAAAATGG - Intronic
1131404303 15:92151550-92151572 TTGCCTATCTTAAAAACAAGAGG - Intronic
1131589964 15:93738423-93738445 ATACTAATCTTAAATGAAAATGG - Intergenic
1131674538 15:94658302-94658324 ATGCATCTCTTTAAAAAAACAGG - Intergenic
1131729166 15:95261009-95261031 AACCTTACCTTCAAAAAAAAAGG - Intergenic
1131844077 15:96470406-96470428 ATACTTATTTTAAAGAAAATAGG + Intergenic
1131853351 15:96565941-96565963 ATCCTTATTAAAAAAAAAAAGGG - Intergenic
1131947300 15:97638681-97638703 AAATTTATCTTAAATAAAAATGG - Intergenic
1131949739 15:97668855-97668877 ATGCTTATATTAGAAAACAAAGG - Intergenic
1133504183 16:6394242-6394264 TTGCTCATCTGAAAACAAAAGGG + Intronic
1134258302 16:12629911-12629933 ATGACTATCTGAACAAAAAAAGG + Intergenic
1134387868 16:13791004-13791026 GTGCTTATTTTAAATGAAAAAGG - Intergenic
1134470079 16:14516877-14516899 ATAATTATTTTAAAAAGAAAAGG + Intronic
1134515556 16:14883890-14883912 CAGCTTCTCTTAAAAAAAAAAGG - Intronic
1134515570 16:14884061-14884083 CAGCTTCTCTTAAAAAAAAAAGG - Intronic
1135824788 16:25717044-25717066 AACTTTGTCTTAAAAAAAAAAGG + Intronic
1136646817 16:31627218-31627240 ATACTTACCTTAAATAAAACGGG + Intergenic
1136696025 16:32082960-32082982 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1136796519 16:33026214-33026236 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
1137929637 16:52574779-52574801 CTCCTTTTCTTAAAAAAAAGGGG + Intergenic
1138116313 16:54363399-54363421 ATGATTTTTTTAAAAAAAACTGG + Intergenic
1138383429 16:56619242-56619264 ATGCCAAAATTAAAAAAAAAAGG - Intergenic
1138733829 16:59227857-59227879 ATTGTTCTTTTAAAAAAAAATGG - Intergenic
1138880033 16:61001912-61001934 AAGACTGTCTTAAAAAAAAAAGG + Intergenic
1138936253 16:61727912-61727934 ATACATAACTTAAAAAAATAAGG - Intronic
1139194552 16:64904097-64904119 AAGTTTATCTTAAAAAGCAAAGG + Intergenic
1140055734 16:71523953-71523975 ATGCTTAGCGTAAAAAAATGAGG + Intronic
1140994876 16:80249359-80249381 ATGGTTATCTTAAAGAAAGTTGG - Intergenic
1141072577 16:80971444-80971466 ATTTTTTTTTTAAAAAAAAAAGG + Exonic
1141409509 16:83822884-83822906 TTGCTTATGAAAAAAAAAAAAGG - Intergenic
1141779438 16:86149878-86149900 ATGCTTCTCTTATAAGAAACTGG + Intergenic
1142773918 17:2120962-2120984 ATGATGAGCTTAAAAAAAAGCGG + Intronic
1142785268 17:2216665-2216687 ATGCTTATTCTCACAAAAAAGGG - Intronic
1143470360 17:7170404-7170426 ACCCTTATCTCAAAAATAAAAGG + Intergenic
1144285742 17:13772222-13772244 ATGCTTATTTTGACAATAAAAGG - Intergenic
1144415938 17:15046498-15046520 ATGCTTATATTAAGAAAAACAGG - Intergenic
1144619211 17:16805719-16805741 TTTCTAATCTTTAAAAAAAAGGG - Intergenic
1144747546 17:17625946-17625968 ATATTGTTCTTAAAAAAAAAAGG - Intergenic
1144893486 17:18509976-18509998 TTTCTAATCTTTAAAAAAAAGGG + Intergenic
1145087353 17:19953285-19953307 ATGCTTATCTTAGAAAAGAAAGG + Intronic
1145114509 17:20196632-20196654 ATTCTTCTCCTAAAATAAAATGG - Intronic
1145138738 17:20434298-20434320 TTTCTAATCTTAAAAAAAAAGGG - Intergenic
1146092034 17:29889033-29889055 TTAGTTTTCTTAAAAAAAAATGG + Intronic
1146193994 17:30795633-30795655 AGGCTTCATTTAAAAAAAAAAGG + Intronic
1146317930 17:31823028-31823050 AAACTTATATTAAAACAAAACGG + Intergenic
1147060839 17:37876891-37876913 ATGAAAATCTTAAAAACAAAAGG + Intergenic
1148410185 17:47459672-47459694 ATGAAAATCTTAAAAACAAAAGG + Intergenic
1148453776 17:47799377-47799399 TTGCTTATTATAAAAAACAATGG - Intergenic
1148709668 17:49669074-49669096 AGACTCATCTCAAAAAAAAAAGG - Intronic
1148803927 17:50254274-50254296 AAGCTGATTTAAAAAAAAAAAGG + Intergenic
1149097362 17:52859565-52859587 ATGCTTAGCTTGAAAAGACAGGG + Intergenic
1149554726 17:57565265-57565287 GTGCTTATCCTACAGAAAAATGG - Intronic
1149672733 17:58429879-58429901 AATTTTACCTTAAAAAAAAAAGG + Intronic
1149738178 17:59016441-59016463 ATGCTTGGCATAAAAAACAAGGG - Intronic
1149862754 17:60132864-60132886 ATACTTATCTTAGTAAAAAATGG + Intergenic
1150320373 17:64208597-64208619 ATGCTTGCTTTAAAAAAAATAGG - Intronic
1150685801 17:67319929-67319951 ATGCATATTTTAAAACCAAAAGG - Intergenic
1151412208 17:73938496-73938518 ATGTTTTCCTTAAAAAAAAAAGG + Intergenic
1151649264 17:75456283-75456305 GGGCTTATTTTAAAAAGAAAGGG + Intronic
1151986209 17:77545446-77545468 ATGGTTATCTAAACAAAAAGGGG + Intergenic
1152114906 17:78379508-78379530 TTGCTAATATTAAAAAAAAGGGG + Intronic
1152431628 17:80251453-80251475 ATGCTTATTGTAAAAAATATGGG + Intronic
1152431954 17:80253271-80253293 ATGCTTATTGTAAAAAATACAGG + Exonic
1153377977 18:4402609-4402631 ATCCTAATGTTAAAAAAAATTGG - Intronic
1153808406 18:8730942-8730964 CTGCTTTTCTTAAAAATAATTGG + Intronic
1153852583 18:9109993-9110015 ATGCTTTTCTTCTTAAAAAAAGG + Intronic
1153998115 18:10459684-10459706 ATGCTTTTATTTCAAAAAAATGG + Intronic
1154152409 18:11916802-11916824 ATGTTTATTAGAAAAAAAAAAGG - Intergenic
1154408618 18:14121341-14121363 ATACTTACTATAAAAAAAAAAGG + Intronic
1154973201 18:21430894-21430916 ATGCCTATATTAAAAAAAAGAGG - Intronic
1155138534 18:23020589-23020611 AAGATTATTTAAAAAAAAAAAGG - Intronic
1155197395 18:23487720-23487742 ATCCTCATTTTAAAACAAAAAGG + Intergenic
1155546620 18:26922547-26922569 ATGAGTATCTAAAAAAAATATGG + Intronic
1155737165 18:29238414-29238436 ATGCTTAGTTTAAAAAGCAAAGG + Intergenic
1155943441 18:31822441-31822463 AACCCTATCTTAAAAAAAAAAGG + Intergenic
1156065971 18:33142939-33142961 ATGCTTTTGTTAAAAAAATATGG - Intronic
1156138223 18:34070955-34070977 ATTCTTACATTAAAATAAAATGG + Intronic
1156187265 18:34677679-34677701 ATGCTTTTTTAAAAAAAAATTGG - Intronic
1156248011 18:35321746-35321768 ATCCTTTTTTTAAAAAAAACTGG - Intergenic
1156356324 18:36344400-36344422 AACCTTGTCTCAAAAAAAAAAGG + Intronic
1156442210 18:37202137-37202159 ATGCTTTTGTTAAAAAAAAATGG - Intronic
1156593254 18:38516266-38516288 ATGTTTATTTTAAAATCAAAAGG + Intergenic
1156598472 18:38575465-38575487 TGGCTTGTGTTAAAAAAAAATGG - Intergenic
1156828413 18:41461813-41461835 ATGCTTTAATTAAAAAAGAAAGG - Intergenic
1157330424 18:46700067-46700089 ATTCTTATTTTAAAATAAAGGGG + Intronic
1158085425 18:53645491-53645513 AGGCTTGTCTTAAGAAAGAAAGG + Intergenic
1158144810 18:54299989-54300011 TTAGATATCTTAAAAAAAAAAGG + Intronic
1158248915 18:55464723-55464745 ATGTCTAGTTTAAAAAAAAAAGG - Intronic
1158279508 18:55806546-55806568 ATGCGTATTTTATACAAAAATGG + Intergenic
1158348240 18:56537650-56537672 ATGCTGGGCTTAAGAAAAAAGGG + Intergenic
1158636197 18:59160468-59160490 ATTGTTTTCTTAAGAAAAAATGG + Intergenic
1158729559 18:60007955-60007977 ATGCTTATTTTTATAAGAAATGG + Intergenic
1158927559 18:62284479-62284501 ATTTTTATCTTAAAAAAATCTGG - Intronic
1158962747 18:62600269-62600291 ATTCTTTTCTTAAAAATAATAGG - Intergenic
1159185217 18:64962369-64962391 ATGCTTATCACAAAAAAAATGGG + Intergenic
1159340837 18:67130721-67130743 ATGCTGCTCTTAAAAACTAAAGG - Intergenic
1159520341 18:69512192-69512214 AACCTTCTCTTACAAAAAAAGGG + Intronic
1159603436 18:70450746-70450768 ATTTTCTTCTTAAAAAAAAAAGG - Intergenic
1159726820 18:71971174-71971196 AGGTTTGTTTTAAAAAAAAATGG - Intergenic
1159768869 18:72524161-72524183 GGGCTTATCTTAAACAAAAAGGG - Intergenic
1159988253 18:74871321-74871343 ATTATTATCTTGAAAAAAGAAGG + Intronic
1160332030 18:78002820-78002842 CTACTTATCTTAGAAAATAATGG + Intergenic
1160836280 19:1126268-1126290 TTTGTTAACTTAAAAAAAAAAGG - Intronic
1161159934 19:2756237-2756259 AAGCTTATTTAAAAAAAAAAGGG + Intronic
1161974728 19:7602051-7602073 AAGATTGTCTCAAAAAAAAAAGG + Intronic
1161987387 19:7663737-7663759 ATCCATTTATTAAAAAAAAAGGG - Intergenic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1164068019 19:21737863-21737885 ATGCTGATCTTATAAAATGAGGG - Intronic
1164094363 19:21992922-21992944 ATGTTTAGCTGAAAAAGAAAAGG + Intronic
1164184158 19:22847255-22847277 ATACTTAATTAAAAAAAAAAAGG - Intergenic
1164288494 19:23844693-23844715 ATTATTATATTATAAAAAAATGG - Intergenic
1164727738 19:30477956-30477978 GTGCTTTTCTAAAAAGAAAAAGG - Intronic
1165180256 19:33961279-33961301 GATCCTATCTTAAAAAAAAAAGG - Intergenic
1165816554 19:38645953-38645975 ATGTTTACATTAAAAATAAATGG - Intergenic
1166591255 19:44001559-44001581 ATTCTTCTTTTTAAAAAAAATGG - Intergenic
1166632883 19:44423107-44423129 ATGATTATCTCAATAAAGAAAGG - Intronic
1167443435 19:49523558-49523580 ACTCTTATCTCAAAAACAAAAGG + Intronic
1168072211 19:53959551-53959573 ATATATATATTAAAAAAAAAAGG - Intergenic
1168476597 19:56680300-56680322 AACCTTTTCTTAAAAAAAACTGG + Intergenic
1168571976 19:57477875-57477897 ATGCTCATCAAAAAATAAAATGG + Intergenic
925002336 2:415251-415273 AAGCTTATTTTTAAAAATAATGG - Intergenic
925297655 2:2788744-2788766 TTTCTGATCTAAAAAAAAAATGG - Intergenic
925554265 2:5112059-5112081 AAACTTATGTTAAAAAATAAGGG + Intergenic
925564259 2:5232643-5232665 CTGCTTATATAAAAACAAAAAGG + Intergenic
925734723 2:6953097-6953119 ATGCTTATATTTTAAAAAGAGGG - Intronic
925786131 2:7432467-7432489 ATGTTTATCATTTAAAAAAATGG - Intergenic
926174742 2:10580621-10580643 AAATTTATCTTAAAATAAAAAGG + Intronic
926616835 2:15004508-15004530 ACTCTTGTCTTAAAAACAAAGGG - Intergenic
926860468 2:17303441-17303463 ATGGCTATCTTAAAAGAGAAAGG + Intergenic
926897393 2:17709052-17709074 ATCCTTATCTGAAAAAAATGTGG - Intronic
926959803 2:18343776-18343798 ATGCTGATGTAAAAAAAGAATGG + Intronic
927185976 2:20482801-20482823 TTGCTTTCCTTAAAAAGAAAAGG - Intergenic
927193469 2:20532585-20532607 ATCCTTACCTTAAAAAATCAAGG - Intergenic
927748842 2:25647868-25647890 ATGCTTACATAAGAAAAAAAAGG + Intronic
928561920 2:32497831-32497853 ATGCTTGTATTAGAAAAGAAAGG - Intronic
928698577 2:33875747-33875769 AAACTTTTATTAAAAAAAAATGG - Intergenic
928822560 2:35379435-35379457 ATATATATCTTAAGAAAAAAAGG - Intergenic
928879202 2:36078236-36078258 ATGATAATCGTCAAAAAAAATGG + Intergenic
928973076 2:37052151-37052173 AAGCTTATTTTAAAATAAAATGG - Intronic
929155927 2:38788514-38788536 ATGCTTATTGTAAAAAAGGATGG + Intergenic
929301873 2:40313459-40313481 ATGTTTAACTTTTAAAAAAACGG + Intronic
930372372 2:50518781-50518803 ATCCTTATGTTAAGAAGAAATGG - Intronic
930388047 2:50722603-50722625 ATGGTTATATTAATATAAAAAGG + Intronic
930533395 2:52617478-52617500 ATGCTATTCTTAAAAGAAAGAGG - Intergenic
932048528 2:68375703-68375725 CTGCTTATCTCAAAATACAAAGG - Intronic
932856961 2:75244541-75244563 AGACTTATCATAAAAAACAATGG - Intergenic
932896935 2:75649415-75649437 CTGGTAAGCTTAAAAAAAAAAGG - Intronic
932953641 2:76324913-76324935 ATGCTTTGCTTAAAAAATTAAGG + Intergenic
933215861 2:79629393-79629415 CTACTTATGTTAAAAAAAGATGG - Intronic
933242586 2:79939784-79939806 ATGATTTTCTTAAAAACACATGG + Intronic
933966463 2:87433671-87433693 AAGATTGTCTAAAAAAAAAAAGG - Intergenic
934101139 2:88654068-88654090 ATTCTTACATTAAAAAAAAAAGG - Intergenic
934482654 2:94666101-94666123 ATGCTGATGTTAAAAGATAATGG - Intergenic
934491915 2:94767263-94767285 ATGCTAATAGTAAAAAAATAAGG + Intergenic
934515971 2:94986891-94986913 TTGCTTATTTAAAAAAAAAAAGG + Intergenic
934901239 2:98161595-98161617 ATAATTATCTCAAAATAAAAAGG - Intronic
935097829 2:99962747-99962769 TTGCTAATATTTAAAAAAAACGG - Intronic
935811872 2:106806471-106806493 ATGGTTTTTTTAAAAAAATAAGG - Exonic
935980639 2:108623403-108623425 ATTCTTTTTTTAAAAAAATAAGG + Intronic
936008259 2:108908782-108908804 ATCCTTTTTTTAAGAAAAAAAGG - Intronic
936612289 2:114012880-114012902 CTCCTTATCTTAAAAATCAATGG + Intergenic
936968811 2:118154246-118154268 ATGCATATATGAAAATAAAAGGG + Intergenic
937005464 2:118508568-118508590 ATGGTTGTCATAAAAAAAGATGG + Intergenic
937500860 2:122477187-122477209 AGGCTTATCTTAAAGATAAGAGG - Intergenic
937548504 2:123056193-123056215 ATGATTATTTGAAAAAATAATGG - Intergenic
937788185 2:125926971-125926993 TTGCTTATTTGTAAAAAAAATGG + Intergenic
937960988 2:127458670-127458692 CTCCATCTCTTAAAAAAAAAAGG + Intronic
938591508 2:132741353-132741375 ATGCCTCTCTTGAAAAACAATGG + Intronic
938921599 2:136000309-136000331 ATGCTTATGATAACAAACAAGGG + Intergenic
938985962 2:136576583-136576605 ATACTTAGCATGAAAAAAAAAGG + Intergenic
939137329 2:138313138-138313160 ATGGTTAGCTTAAAGAAAATTGG - Intergenic
939273834 2:139973702-139973724 ATACTTATATCATAAAAAAATGG + Intergenic
939650164 2:144750682-144750704 ATGCTTATATTGGAAAACAAAGG + Intergenic
939705290 2:145445429-145445451 AAGCTTATAGTGAAAAAAAATGG - Intergenic
939731951 2:145795900-145795922 AGGCTTATTAGAAAAAAAAATGG - Intergenic
939951176 2:148475448-148475470 TTCCTTGTATTAAAAAAAAAAGG + Intronic
940351221 2:152690818-152690840 ATCCTTGTCATAGAAAAAAAGGG + Intronic
940378129 2:152980899-152980921 AGGCTTGTTTTAAAAGAAAAAGG + Intergenic
940409964 2:153350185-153350207 AAGTTTATTTTAAAAATAAATGG + Intergenic
940544610 2:155067805-155067827 ATGCTTCTCTTAAAATATACAGG - Intergenic
940674136 2:156708233-156708255 ACTCTGATCTTAAAAGAAAAAGG + Intergenic
940692898 2:156941555-156941577 ATGTTTTCCTGAAAAAAAAATGG + Intergenic
941032651 2:160530570-160530592 GTGGTTTTTTTAAAAAAAAAAGG - Intergenic
941163861 2:162064313-162064335 ATGATTTTCTTAAAATGAAAAGG - Intronic
941249722 2:163147218-163147240 ATGATTTTCTTTAACAAAAATGG + Intergenic
941613155 2:167685922-167685944 CTGCTTTACTTAAATAAAAAAGG + Intergenic
941659036 2:168176090-168176112 ATTCTTAACTTCAAAAAGAATGG + Intronic
941840262 2:170075192-170075214 ACCCTTTTTTTAAAAAAAAAGGG + Intronic
942007485 2:171719671-171719693 ATTCTTTTTTTAAATAAAAATGG + Intronic
942103823 2:172613461-172613483 CTCCATCTCTTAAAAAAAAAAGG - Intergenic
942201316 2:173574224-173574246 ATGCCCATCTTTTAAAAAAATGG - Intergenic
942225678 2:173813346-173813368 ATGTTGATCTTAAAGGAAAAGGG + Intergenic
942264661 2:174210366-174210388 ATGCGTATTTTAAACAAAATAGG - Intronic
942575472 2:177358807-177358829 ATGATCATTTTAGAAAAAAATGG - Intronic
942900000 2:181104247-181104269 ATGAGTCTCTTAAAAAATAATGG + Intergenic
943267999 2:185762114-185762136 ATGCTTATTCTAAAAAATTAAGG + Intronic
943373223 2:187042526-187042548 ATGCCTATCTTTATAAAAATGGG + Intergenic
943633923 2:190284371-190284393 AGGCTTCTGTAAAAAAAAAATGG + Intronic
943992748 2:194718377-194718399 TTGGTTATCTTAGAAAAATATGG + Intergenic
944104429 2:196064011-196064033 ATGTTTATTTTTAAAAAGAAAGG + Intronic
944117330 2:196203245-196203267 ATGCTTATTGTATCAAAAAAGGG - Intronic
944194464 2:197037931-197037953 GACCTTGTCTTAAAAAAAAATGG + Intronic
944587754 2:201187427-201187449 AGGCATATTTAAAAAAAAAAAGG - Intronic
944727540 2:202486151-202486173 ATGCTTGTCTTAAGAAAGAAAGG + Intronic
944773929 2:202942680-202942702 ATACACATCTTTAAAAAAAATGG + Intronic
944774678 2:202951053-202951075 AACCTTGTCTCAAAAAAAAAGGG - Intronic
944794848 2:203172635-203172657 ATGGTTATCTAAAGACAAAAAGG - Intronic
945116572 2:206414050-206414072 ATATTTACCTTAAAAATAAATGG - Intergenic
945135197 2:206619517-206619539 GTTCTTTTCCTAAAAAAAAAAGG - Exonic
945231079 2:207590835-207590857 ATACTTATGTTAGAAAAAAAGGG - Intronic
946454275 2:219811372-219811394 AAGCTTATTTTAAAAAATAATGG - Intergenic
946505081 2:220290546-220290568 ATTCTTATCTAAAAGAAGAATGG - Intergenic
946882253 2:224188167-224188189 ATGTTTATAATAAAAAAACAAGG + Intergenic
947108710 2:226695683-226695705 ATGCCTATTTTACAAATAAATGG - Intergenic
947145433 2:227059705-227059727 ATACTTTTCTTAAAAACACAGGG + Intronic
948125210 2:235559740-235559762 AAGCATATTTAAAAAAAAAAAGG - Intronic
948236691 2:236396358-236396380 ATTCTTTTCTTAAAAATCAAAGG - Intronic
948254815 2:236558732-236558754 ATGGTTATTTCAAAATAAAAAGG + Intergenic
948612303 2:239177653-239177675 ATGTTTGTCTTAATAACAAAAGG + Intronic
1169018995 20:2314710-2314732 AAGCCTATCTCCAAAAAAAAAGG + Intronic
1169144196 20:3241713-3241735 AACCCTATCTCAAAAAAAAAAGG + Intergenic
1169175699 20:3511138-3511160 ATGCATACATTAAAAAAGAAAGG + Intronic
1169305599 20:4487682-4487704 ATATATATATTAAAAAAAAAAGG + Intergenic
1169331852 20:4722578-4722600 CTCCTTATATTAAAAAAAAAAGG - Intronic
1169553738 20:6727805-6727827 ATGCTCATCATTAAAAAAATTGG + Intergenic
1169581492 20:7028266-7028288 TTCCTTTTCTAAAAAAAAAATGG - Intergenic
1169805576 20:9556160-9556182 TTGCTTCTCTTAAGAAAGAACGG - Intronic
1170361545 20:15551921-15551943 ATAATTATCATAAATAAAAAAGG - Intronic
1170403811 20:16015012-16015034 TTGCTTCTATTAAAAAAAAGAGG - Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1170519518 20:17169542-17169564 ATTCTCATCTTTAAAAAGAAGGG - Intergenic
1170550689 20:17473574-17473596 ATTCTTATTTTAAAGCAAAAAGG - Intronic
1170621031 20:17996196-17996218 ATGCTGTTCCAAAAAAAAAATGG - Intronic
1170753404 20:19172718-19172740 ATGCTTATGTTCCAAAAGAAAGG + Intergenic
1171497644 20:25567961-25567983 ATGCTTATAATAGAAAAGAAGGG + Intronic
1171539832 20:25940159-25940181 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1171801227 20:29620179-29620201 ATGCTTACCTTGAAAGAAAGAGG + Intergenic
1171842751 20:30235378-30235400 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1172172257 20:32944875-32944897 AAGCTTATCTGAATAAATAATGG - Intronic
1172536394 20:35676872-35676894 ACTCTTGTCTCAAAAAAAAAGGG - Intronic
1172666070 20:36601187-36601209 ATGTTTAATTTAAAAAAGAACGG + Intronic
1173292924 20:41730051-41730073 ATCCTTACCTGAAAAAGAAATGG - Intergenic
1173611788 20:44373676-44373698 AAGTTTAATTTAAAAAAAAAAGG - Intronic
1174661500 20:52217164-52217186 GAGCTTATCTGAAAAAATAATGG - Intergenic
1174701999 20:52618453-52618475 ATGCTTTCTTTAAAAACAAAAGG + Intergenic
1174869049 20:54166723-54166745 GTCCTTTTTTTAAAAAAAAAAGG - Intronic
1174879689 20:54265593-54265615 ATGGTTAGCATAAATAAAAATGG - Intergenic
1175707566 20:61192321-61192343 AAGCTCAAATTAAAAAAAAAAGG - Intergenic
1177077273 21:16592464-16592486 ATACTAAGCTTAAAATAAAAAGG + Intergenic
1177394620 21:20516620-20516642 AGGCTTCTCTTGAAAAAAAATGG + Intergenic
1177400787 21:20602733-20602755 ATGTTTTTTTTAAAAAAAATTGG - Intergenic
1177466780 21:21494904-21494926 GTGCTTATTTTGAAAAAAATTGG - Intronic
1177475332 21:21613151-21613173 AAGAAAATCTTAAAAAAAAATGG - Intergenic
1178239100 21:30878824-30878846 GTGCTTATTTTAAAAAGAGAGGG + Intergenic
1178576649 21:33798407-33798429 ATCCCTTTTTTAAAAAAAAAAGG - Intronic
1178739286 21:35182768-35182790 ATAATAATCTGAAAAAAAAAAGG - Intronic
1178829767 21:36045951-36045973 ATGCTTTTCTGAAACTAAAAAGG + Exonic
1178966280 21:37121756-37121778 ATGCTTAAGTTAAAGAAAACAGG - Intronic
1179511088 21:41874150-41874172 TTGCTTAATTTAAAAAAAAAAGG + Intronic
1180178395 21:46103514-46103536 ATGCTTATATTAAAAAAGACAGG - Intronic
1180933159 22:19607124-19607146 ATGCCTTACTTAAAACAAAACGG - Intergenic
1181132234 22:20738806-20738828 TTGCTTAAAATAAAAAAAAAAGG + Intronic
1182658728 22:31910046-31910068 GACCTTATCTCAAAAAAAAAAGG + Intergenic
1182747995 22:32620577-32620599 ATGGTTGTCTTAAAAGAAAGAGG + Intronic
1183972587 22:41489045-41489067 GATCTTATCTCAAAAAAAAAAGG - Intronic
1184427506 22:44421508-44421530 ATTCTAATGTTAGAAAAAAAAGG - Intergenic
1185207458 22:49548274-49548296 ATGCGTATCTTTCAAAAAAGGGG + Intronic
1203324737 22_KI270738v1_random:3372-3394 CTGATGAGCTTAAAAAAAAAAGG - Intergenic
949156938 3:839103-839125 ATGCATATCTTATAAACTAAAGG + Intergenic
949511990 3:4774428-4774450 ATGCTTACTGTAAAAAAAATGGG - Intronic
949688488 3:6607083-6607105 ATAATTATATTAAATAAAAATGG - Intergenic
949848538 3:8397691-8397713 ATGCTGAACTTACAAAAGAAGGG - Intergenic
949969129 3:9387699-9387721 ATGCATATTTTTAAAAAAATAGG + Intergenic
950047365 3:9957319-9957341 ATGAATGTCTTGAAAAAAAAGGG + Intergenic
950056726 3:10030890-10030912 ACTCTTATCTCAAAAAAAAAAGG + Intronic
950164686 3:10785397-10785419 ATGCTTGTCTCAAAATAAAAAGG - Intergenic
950223650 3:11215903-11215925 TTGTTTAAGTTAAAAAAAAAAGG - Intronic
950276136 3:11662708-11662730 TTGCTTTTCTTAATTAAAAAAGG + Intronic
950379554 3:12599902-12599924 ATGTTTATCTTTAAAAGATATGG - Intronic
950823892 3:15794318-15794340 AGTATTATATTAAAAAAAAAAGG + Intronic
951048961 3:18072999-18073021 ATGCTTTTCTTAAACACATACGG - Intronic
951176576 3:19608040-19608062 ATGCTTAAAAAAAAAAAAAAAGG + Intergenic
951280178 3:20738392-20738414 TTTCTTTTTTTAAAAAAAAAAGG - Intergenic
951410324 3:22356377-22356399 ATGCTTTCCTTAAAAAATCAAGG - Intronic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
951823732 3:26843660-26843682 TTGCTTATCTTAAAAGTAGAAGG - Intergenic
951872350 3:27377987-27378009 ATAATTATCATAAAAAATAAAGG - Intronic
951897950 3:27628341-27628363 ATGCTTAACTTTATAAGAAACGG - Intergenic
952000573 3:28781243-28781265 AGGATTATCTTAAAATAACAAGG - Intergenic
952015286 3:28949418-28949440 ATACTTATACTAAAAAAAAATGG + Intergenic
952391022 3:32880333-32880355 AAACTGATCTTAAAAATAAATGG - Intronic
952713497 3:36454557-36454579 ATGCTAATCTTAGAAAGACATGG + Intronic
953026669 3:39149215-39149237 ATGCAAATGTTCAAAAAAAAAGG + Intronic
953114343 3:39977113-39977135 AGGTTTATTTTAAAAAAAAACGG + Intronic
953395012 3:42561983-42562005 CTGATTAACTCAAAAAAAAAGGG + Intronic
953679332 3:45027926-45027948 AAACTCATGTTAAAAAAAAAAGG + Intronic
953717448 3:45328086-45328108 ATGTTTATCTTCATGAAAAAGGG - Intergenic
954311437 3:49771361-49771383 AAGCCAATTTTAAAAAAAAATGG + Intronic
955556738 3:60146240-60146262 ATACTCATTTAAAAAAAAAAAGG + Intronic
955560092 3:60179563-60179585 ACCCTGTTCTTAAAAAAAAATGG - Intronic
955624095 3:60898157-60898179 ATGTTTATATTAAATGAAAATGG - Intronic
956147719 3:66208356-66208378 ATGATTTCCTTTAAAAAAAAAGG - Intronic
957199241 3:77111268-77111290 ATACTTATTTTAAAATAAAAAGG - Intronic
957226158 3:77450330-77450352 ATGCATATTTTAGAGAAAAAGGG + Intronic
957360507 3:79150559-79150581 ATACTTATCTTTACTAAAAAAGG + Intronic
957379961 3:79414593-79414615 ATGATTATCTCAAATTAAAAAGG - Intronic
957609634 3:82450256-82450278 GTACTTAACTTAAAAGAAAACGG + Intergenic
957614652 3:82510559-82510581 ATGCAAATCTGAAAAAAAAAAGG - Intergenic
957784075 3:84858059-84858081 AGGATTTTCTTAAAAGAAAATGG + Intergenic
958026405 3:88055209-88055231 ATGGTTATCTTTAAAATTAATGG - Exonic
958650290 3:96929224-96929246 ATACTAATCTTAAAAGAAAATGG - Intronic
958959588 3:100496180-100496202 ATGATTATCTGAGAGAAAAAGGG - Intronic
958987383 3:100797818-100797840 ATTGTTTTCTTAAAGAAAAAAGG + Intronic
959182069 3:102993589-102993611 ATACATATCTTAAACAAAAGAGG - Intergenic
959238854 3:103761947-103761969 ATGCATATTTTAAAATAAGAAGG - Intergenic
959321384 3:104879640-104879662 ATACTTATTGGAAAAAAAAATGG - Intergenic
959389240 3:105753366-105753388 CTGTTTTTTTTAAAAAAAAAAGG + Intronic
959456558 3:106570411-106570433 AGCCTCATCTTAAAAAAAGAGGG + Intergenic
959459118 3:106602899-106602921 AAGCTATTCTTCAAAAAAAAAGG - Intergenic
959766329 3:110034187-110034209 ATACTTATTTTAGACAAAAAAGG - Intergenic
960167351 3:114418502-114418524 AGCCTTATCATAAGAAAAAATGG + Intronic
960170457 3:114454709-114454731 ATACTTCTTTAAAAAAAAAATGG + Intronic
960222080 3:115125023-115125045 AAGTTTTTTTTAAAAAAAAAAGG + Intronic
960252909 3:115476312-115476334 ATGTTTTTCTTTAAAAACAAAGG - Intergenic
960299276 3:115982454-115982476 TTGTTTATTTTAAATAAAAAGGG + Intronic
960482479 3:118209932-118209954 ATTCTTCTGTTAAAAAAAGAGGG + Intergenic
961691252 3:128671465-128671487 ATACTGCTCTTAAAAAATAAAGG - Intronic
961989431 3:131171957-131171979 ATGCTTATATAAAAGAAAATAGG + Intronic
962807936 3:138939906-138939928 CTGCTTTTCTGAAAAAGAAAAGG + Intergenic
963181001 3:142355952-142355974 ATGCTGAGCTTTAGAAAAAAAGG - Intronic
963261734 3:143198951-143198973 TTTATTATCTTAAAAGAAAAGGG + Intergenic
963358640 3:144241878-144241900 ATGCTTTTCTAATAAAACAAGGG - Intergenic
963593610 3:147297044-147297066 ATGTTGATCTTAAAAATAAGTGG + Intergenic
963685224 3:148425203-148425225 ATGGTTATCATAAAAACAACTGG + Intergenic
964005525 3:151822908-151822930 ATGGTTATATTAAAAATTAAGGG + Intronic
964018717 3:151980217-151980239 ATGATTAAATTAAAAAAATAAGG + Intergenic
964345102 3:155747107-155747129 ATGCTTTATTTAAAAAAGAAGGG - Intergenic
964563928 3:158028874-158028896 ATGCATTTCTTTAAAAAAATTGG + Intergenic
964666671 3:159182201-159182223 ATACTTTTTTTAAAAAAAACAGG + Intronic
964797857 3:160519489-160519511 GTGGTTATGTTAAAAAAAATAGG + Intronic
964822021 3:160781179-160781201 ATTCTTTTCCTAAAAAATAAGGG - Intronic
964843851 3:161024969-161024991 ATGCTTATTTAAGAAGAAAATGG - Intronic
964871198 3:161315369-161315391 TTGCTTTTTTTAAAATAAAAAGG + Intergenic
964877971 3:161391024-161391046 ATGCTTGTCATAACAAAAATTGG + Intergenic
964900299 3:161651094-161651116 ATGTTTATAGGAAAAAAAAATGG - Intergenic
965294691 3:166928852-166928874 ATGTTTAAGTTAAAAAAAAGAGG - Intergenic
965384694 3:168031933-168031955 TTCCCTTTCTTAAAAAAAAATGG - Intronic
965426182 3:168526622-168526644 AAACTTATCTTCAAACAAAAGGG - Intergenic
965454287 3:168878369-168878391 AGTCTTTTCTTAAAAAAACAGGG + Intergenic
965506462 3:169520766-169520788 ATCTTAATCTCAAAAAAAAATGG + Intronic
965532328 3:169785051-169785073 ATGGTTATTATGAAAAAAAAGGG + Intronic
965633691 3:170759324-170759346 TTGTTTATCTTTAAAAAAAAGGG - Intronic
965734809 3:171809470-171809492 AGGCTTATCTTAACTAAAATTGG + Intronic
965859008 3:173124591-173124613 TTGTTTTTCTTAAAAGAAAAGGG - Intronic
966013206 3:175107947-175107969 ATTCTTATCTATAAAAAAAATGG + Intronic
966676954 3:182600056-182600078 AAGCTTATTTAAAAAAAAGAGGG + Intergenic
966895331 3:184440594-184440616 TTTCTTACCTGAAAAAAAAAAGG - Intronic
967114055 3:186320736-186320758 ATGAGAATGTTAAAAAAAAAAGG + Intronic
967418555 3:189247282-189247304 ATGGATATTTTAAAAGAAAAAGG - Intronic
967476008 3:189920160-189920182 ATGCTTATGTTAGAAAAAAAGGG + Intergenic
967508639 3:190283868-190283890 ATGCCTATATGAAAAACAAATGG - Intergenic
967655248 3:192040654-192040676 ATCCTTATCTAAAAAAATAGTGG - Intergenic
967945775 3:194802534-194802556 ATGCAGATATGAAAAAAAAATGG - Intergenic
968665144 4:1816940-1816962 AAGTTTGTCTTAAAAGAAAAAGG + Intronic
969545290 4:7822539-7822561 ATGTTTTTATTCAAAAAAAACGG + Intronic
970038908 4:11773580-11773602 TTGCTTGTCTTAGAAAAATATGG + Intergenic
970236455 4:13963645-13963667 ATGCTTTTACCAAAAAAAAAAGG - Intergenic
970512461 4:16794814-16794836 ATGCTTAAGTTAAATCAAAAAGG - Intronic
970775250 4:19667061-19667083 ATTCTTATCCTTAATAAAAAAGG - Intergenic
971164533 4:24169557-24169579 AAGTTTATTTAAAAAAAAAAAGG + Intergenic
971239805 4:24878247-24878269 TTGCTTAGCTTCAAAAACAAAGG + Intronic
971254687 4:25003661-25003683 GTGATTATCTTTAAAAGAAAAGG + Exonic
971269978 4:25133812-25133834 ATTATTCCCTTAAAAAAAAAAGG + Intronic
971287169 4:25301867-25301889 ATACATATATTAAAAATAAAAGG + Intergenic
971341801 4:25776353-25776375 TTGCCCATCTGAAAAAAAAAAGG + Exonic
971353778 4:25876183-25876205 TTCCTTATCTTAAAAAAAAAAGG - Intronic
971445793 4:26746835-26746857 ATTATTAAGTTAAAAAAAAAAGG + Intronic
971549303 4:27929119-27929141 ATGTTAAACTTATAAAAAAAAGG + Intergenic
971572165 4:28227279-28227301 ATGCCTGTTTAAAAAAAAAAGGG + Intergenic
971574460 4:28255670-28255692 ATGCTAATCTTAAATGTAAATGG + Intergenic
972113884 4:35603236-35603258 ATGCTTTGTGTAAAAAAAAAAGG + Intergenic
972148278 4:36056749-36056771 ATGCTTATAGAAAAGAAAAATGG - Intronic
972414828 4:38828311-38828333 ACACTTATCTTACAAAAGAATGG - Exonic
972455357 4:39248502-39248524 ATACTAATCTTAAATATAAATGG + Intronic
972701004 4:41493174-41493196 ATACTTACCTTAAATATAAATGG - Intronic
972856329 4:43112003-43112025 TTCCTTTTCTTAAAAAAAAAAGG + Intergenic
973039760 4:45456023-45456045 ATGAGTATTTTAAAAAAAACAGG + Intergenic
973305637 4:48646063-48646085 AAGCTTATTTTAAAGAAAAAAGG + Intronic
973581705 4:52350444-52350466 ACGCCTCTCTTAATAAAAAAAGG - Intergenic
974003386 4:56532369-56532391 TTGCTTTTCATTAAAAAAAAAGG - Intronic
974008020 4:56579466-56579488 ATGCCTATATTAAAAAAAAAAGG + Intronic
974246584 4:59327981-59328003 AGGCTTTACTTAAATAAAAAGGG - Intergenic
974550135 4:63361576-63361598 ATGCTTAGGTTCAATAAAAATGG - Intergenic
974727871 4:65819143-65819165 AAGCTTGTTTTAAAAAATAATGG + Intergenic
975316509 4:72959353-72959375 ATCATCATCTCAAAAAAAAATGG - Intergenic
975530835 4:75397482-75397504 CTGCTTATCTGAGAACAAAAAGG - Intergenic
975798926 4:78038136-78038158 ACCCTTATTTAAAAAAAAAATGG - Intergenic
976228955 4:82820621-82820643 ATGGCTATCCTAAAAGAAAAGGG + Intronic
976415322 4:84767110-84767132 ATGCTTTTGAAAAAAAAAAATGG - Intronic
976441509 4:85081293-85081315 GATCTTATCTCAAAAAAAAAAGG - Intergenic
976673488 4:87679518-87679540 ATATTTCTCTTAAAAAAAACAGG + Intergenic
976703648 4:87999213-87999235 ATCCTTATCTTTAAGAAGAAAGG + Intergenic
976898160 4:90137789-90137811 ATGATTAACGTAAACAAAAACGG - Intronic
977084245 4:92574285-92574307 ATACTAATCTTAAATATAAATGG - Intronic
977583356 4:98748261-98748283 ATGTTTACCACAAAAAAAAAAGG + Intergenic
978071590 4:104479202-104479224 ATGTTTCTCTTCAATAAAAAAGG - Intronic
978425876 4:108581709-108581731 ACTGTTATCTTAAAAAATAAAGG + Intergenic
978518455 4:109594647-109594669 AGACTTGTCTCAAAAAAAAAAGG + Intronic
978700591 4:111639617-111639639 ATCCTTATCTTTAAAAAATGGGG + Intergenic
978764014 4:112385940-112385962 ATGCTTATTTGAAAAACAGAGGG - Intronic
978935966 4:114376399-114376421 ATTTTTATCTTAATAAAAATAGG - Intergenic
979035642 4:115713227-115713249 ATCCTTGTTTTCAAAAAAAAAGG + Intergenic
979101648 4:116624356-116624378 TTGCTTATCTTGTATAAAAATGG + Intergenic
979152717 4:117341030-117341052 ATGCTAATCTTAAACGTAAATGG - Intergenic
979371508 4:119893866-119893888 ATTCCTATCAGAAAAAAAAAGGG + Intergenic
979402026 4:120260592-120260614 ATGCTTGTGGTAAAAAAAAATGG - Intergenic
979597694 4:122552877-122552899 ATCCTTATATTTAAAAAATAAGG - Intergenic
979626239 4:122848398-122848420 ATAATTATGTTAAACAAAAAGGG + Intronic
980187711 4:129482561-129482583 ATATATATTTTAAAAAAAAAAGG - Intergenic
980626284 4:135378855-135378877 ATGTTTATCTTAAATGTAAATGG - Intergenic
980810666 4:137875093-137875115 AAGTTTATTTTAAAACAAAACGG + Intergenic
981394566 4:144232970-144232992 ATGCTTAGTTTTAAAGAAAATGG + Intergenic
981531578 4:145759304-145759326 TTGCTAATCTTAAAAAGTAATGG - Intronic
981629562 4:146803264-146803286 ATGCTTCTCTTAAACATCAAAGG + Intronic
981649641 4:147041431-147041453 AAGTTTGACTTAAAAAAAAAAGG + Intergenic
981797967 4:148619703-148619725 ATGTATATATTAGAAAAAAAAGG + Intergenic
981858321 4:149323008-149323030 ATTCATTTCTTAAAAAAAACAGG + Intergenic
982288517 4:153758672-153758694 ATGCTTATAGCAAAAAATAAGGG - Intronic
982837707 4:160143058-160143080 ATCCACATCTTAAAAAAAAGGGG - Intergenic
983009073 4:162522447-162522469 ATTCTTTTTTTTAAAAAAAAAGG - Intergenic
983011815 4:162556695-162556717 ATCATCATTTTAAAAAAAAATGG - Intergenic
983126790 4:163962787-163962809 AAGCTTATTTTAAAAAAAAGTGG - Intronic
983260185 4:165447816-165447838 ATTCTTTTTTTAAAAAAACAAGG + Intronic
983738400 4:171092751-171092773 ATGTTTATCTTTAAAATAATAGG + Intergenic
984118699 4:175714768-175714790 ATATATTTCTTAAAAAAAAACGG - Intronic
984361320 4:178737172-178737194 ATCCTTATCTTCAAGAAAAAAGG + Intergenic
984498484 4:180529586-180529608 ATCCTTATCCTAAAACAAACAGG + Intergenic
984677033 4:182561436-182561458 ATTTGTATATTAAAAAAAAAAGG + Intronic
985037276 4:185853135-185853157 ATCCTTAACTTGAAGAAAAAGGG + Intronic
985200681 4:187481888-187481910 ACGCCTATATTAAATAAAAACGG + Intergenic
985297505 4:188451103-188451125 ATGATTATTTTAGAAAATAAAGG + Intergenic
986386531 5:7239625-7239647 ATGTTTAACTAAAAAATAAATGG - Intergenic
986607552 5:9537052-9537074 ATGCTTTTCAAAAAAGAAAATGG + Intronic
987054719 5:14180483-14180505 ATTTTTAACTTAAATAAAAAAGG + Intronic
987240269 5:15990287-15990309 ATGCCTACATTTAAAAAAAAAGG - Intergenic
987542011 5:19268249-19268271 ATGATTTTGTTAAAAATAAAGGG + Intergenic
987584543 5:19837404-19837426 ATAATTTTTTTAAAAAAAAAAGG + Intronic
988188249 5:27896429-27896451 TTACTTTTTTTAAAAAAAAAGGG - Intergenic
988259620 5:28868025-28868047 TTTCTTATCTAAAAAAATAAAGG + Intergenic
989151440 5:38303752-38303774 ATGCTTTTTTTCCAAAAAAATGG + Intronic
989230886 5:39085653-39085675 ATACCTATCTTCAATAAAAATGG + Intergenic
989427144 5:41309069-41309091 AAACTTATCCTAAAGAAAAAGGG - Exonic
989445133 5:41519104-41519126 TTGCTTTTTTTTAAAAAAAAGGG - Intergenic
989468686 5:41789099-41789121 TTGCTTATATTAGAGAAAAAAGG + Intronic
989597189 5:43167409-43167431 ATGTTTAAGTTAATAAAAAATGG + Intronic
990290293 5:54343454-54343476 AAGTTTATCTGAAATAAAAATGG + Intergenic
990759060 5:59108591-59108613 ATTCTTACCTTAAAAAATATTGG + Intronic
990886177 5:60596285-60596307 AAAGTAATCTTAAAAAAAAAAGG + Intergenic
991043454 5:62198298-62198320 AAGCTTATCTGATGAAAAAAGGG + Intergenic
991349190 5:65703143-65703165 ATGATAATATTGAAAAAAAATGG + Intronic
991394415 5:66189063-66189085 ATACATATATTAAAAAAGAAAGG - Intergenic
991461502 5:66863792-66863814 ATGCTTTACTGAAAAAAGAAGGG + Intronic
991481303 5:67083245-67083267 ATGATTAACTTAAAAGGAAAAGG + Intronic
991584720 5:68190272-68190294 AAGCATATTTCAAAAAAAAAAGG + Intronic
991724484 5:69522613-69522635 ACATTTATCTTAAAAAACAAGGG - Intronic
991933391 5:71778420-71778442 ATGCTTAGCTTAAACAAAAACGG + Intergenic
991987416 5:72303739-72303761 AAGATTATCTTTAAAAAATAAGG + Intronic
992043084 5:72856661-72856683 AGGCTTATATTTAAAAACAAGGG - Intronic
992270464 5:75057528-75057550 CTGATTATCTTAAAGAAATAGGG + Intergenic
992272229 5:75077006-75077028 ATGCCTTTTTTAAAAATAAAAGG + Intronic
992369138 5:76124833-76124855 ATGCTTATTTTAAAAAGAACTGG - Intronic
992535889 5:77703031-77703053 ATGTTTTTCCTAAAAATAAAGGG - Intronic
992920647 5:81514136-81514158 AGCATAATCTTAAAAAAAAAGGG - Intronic
992989051 5:82264657-82264679 ATGTGTATCTTCAAAAACAAGGG - Intronic
993250666 5:85517199-85517221 ATTCTTAGATTAAAAAGAAAAGG - Intergenic
993283216 5:85955892-85955914 AAACTTATATTAAAAAAGAAAGG - Intergenic
993334500 5:86641200-86641222 GTGCTTATCTTAGAAAGAAATGG + Intergenic
993387224 5:87274290-87274312 ATGATTTTTTTAAAAAAGAAAGG - Intronic
993635999 5:90344268-90344290 AAGTTTATCTTAAAAACAATGGG + Intergenic
993699854 5:91105822-91105844 ATGCTTATTTCATAAACAAATGG - Intronic
993712322 5:91238146-91238168 ATGATTATCTTTAATAAAAATGG - Intergenic
993727647 5:91386644-91386666 ATTTTTATTTTTAAAAAAAAAGG + Intergenic
993755078 5:91718887-91718909 ATTTGTATCTTAATAAAAAATGG + Intergenic
993815805 5:92543613-92543635 ATGATCAGCTTAAAAAGAAATGG - Intergenic
993887312 5:93430698-93430720 ATGCATATCTTAATAGAAACAGG + Intergenic
994522185 5:100854165-100854187 ATTTGTAACTTAAAAAAAAAAGG + Intronic
994596108 5:101837686-101837708 ATTCTTATATTAAATAAAATAGG - Intergenic
994956078 5:106534735-106534757 ATGCTTACTTTAAATATAAATGG - Intergenic
995614504 5:113945875-113945897 AAGCTTATTTAAAAAAAAAATGG + Intergenic
995625111 5:114067950-114067972 ATGTTTACTTTAAAATAAAATGG + Intergenic
995825121 5:116288507-116288529 GAGCTTATCTGAAGAAAAAATGG - Intronic
996159367 5:120144405-120144427 TGGTTTATCTCAAAAAAAAATGG - Intergenic
996384202 5:122893283-122893305 ATGGTCATCAAAAAAAAAAATGG - Intronic
996492123 5:124110342-124110364 CTGCTTCTCTTACAAGAAAAGGG + Intergenic
996749702 5:126876132-126876154 AAGGTTATCTCAAGAAAAAATGG - Intronic
996931932 5:128899815-128899837 ATAATAATCTTAAAAATAAAAGG - Intronic
997154022 5:131531947-131531969 ATATTTAAATTAAAAAAAAATGG + Intronic
997332595 5:133076554-133076576 TTGTTTATCTAAAAAAAAAGAGG - Intronic
997492752 5:134292480-134292502 ATGCTCATATTAGAAAAGAAAGG + Intronic
997724076 5:136105669-136105691 TTTCTTATGTTAAAAAAAAAAGG - Intergenic
997891248 5:137679025-137679047 ATGTTTAACTTAAAAACTAAAGG - Intronic
998114728 5:139527577-139527599 ATGGTTATCTTCAAAAATAAAGG + Intronic
998193682 5:140047483-140047505 ATGGATATGTTGAAAAAAAAAGG - Intergenic
998194023 5:140051035-140051057 CTGCTTTATTTAAAAAAAAAAGG + Intergenic
998515119 5:142746295-142746317 ATGCTGATTTTTAAAATAAATGG + Intergenic
998725901 5:145014396-145014418 TTTCATAACTTAAAAAAAAAGGG - Intergenic
998748572 5:145291036-145291058 ATCATTACTTTAAAAAAAAAGGG + Intergenic
998819325 5:146044005-146044027 ATGATTAACTTTATAAAAAATGG + Intronic
999037734 5:148372231-148372253 TTGCTTTTCTTTAAAAAATAAGG - Intergenic
999058160 5:148604250-148604272 ATGCGTATCTGAAAAATAAATGG + Intronic
999073515 5:148772951-148772973 ATGCTTTTCTTAAGAATACATGG - Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999862570 5:155664270-155664292 TTCCTTATCTTAACACAAAAAGG - Intergenic
999881104 5:155864828-155864850 ATGCTTATCTTAGGAAAAATAGG + Intergenic
999956447 5:156708251-156708273 ATGCTTTTCTTAAAACTAAAAGG - Intronic
1000115183 5:158147506-158147528 CTGCTTAACTTAATAAACAAGGG - Intergenic
1000369640 5:160522155-160522177 ATGTGTATCTTAATAAAACAGGG + Intergenic
1000558356 5:162755058-162755080 CTCCCTCTCTTAAAAAAAAAAGG + Intergenic
1000845365 5:166273322-166273344 TTTCTTATTTTAGAAAAAAAGGG + Intergenic
1000942374 5:167377465-167377487 ATGCTTATTTTAAAATATACAGG + Intronic
1001072728 5:168600815-168600837 TTAGTTTTCTTAAAAAAAAAAGG + Intergenic
1001172526 5:169433936-169433958 ATGCATATTTTACAGAAAAATGG + Intergenic
1001834094 5:174816047-174816069 AAGCTTATCCTAAGAAATAATGG - Intergenic
1002352278 5:178591398-178591420 TTATTTTTCTTAAAAAAAAATGG - Intergenic
1002361596 5:178675880-178675902 ATGATCATCTTAATAAAAACAGG - Intergenic
1003397846 6:5768648-5768670 ATGCTCATTTTAAAAACAAAAGG - Intronic
1003765993 6:9237340-9237362 ATGCTAATGTTTAATAAAAATGG + Intergenic
1003894540 6:10594851-10594873 GACCTTATCTCAAAAAAAAAAGG - Intronic
1004026662 6:11825881-11825903 TTGCATATCTAAATAAAAAATGG - Intergenic
1004046005 6:12023654-12023676 ATAATTATCTGCAAAAAAAAAGG - Intronic
1004217245 6:13714121-13714143 AGGGATACCTTAAAAAAAAATGG - Intergenic
1004321382 6:14634174-14634196 ATGCCTTTCTTGGAAAAAAAAGG - Intergenic
1004321769 6:14637180-14637202 ATGTTTATTTTAAAACAAAAAGG - Intergenic
1004859616 6:19789132-19789154 ATTTTTTTTTTAAAAAAAAAAGG + Intergenic
1004926181 6:20417156-20417178 AGGCTTATCTGAAAATGAAATGG + Intronic
1005001402 6:21245456-21245478 CTCTTTATCTTAATAAAAAAAGG + Intergenic
1005132806 6:22530277-22530299 ATTCTTATCTGTAAAAATAACGG - Intergenic
1005434950 6:25799386-25799408 ATCCAAAACTTAAAAAAAAAAGG - Intronic
1005751831 6:28890620-28890642 TTGCTTATCTTAAATTGAAAAGG + Intergenic
1005825917 6:29631902-29631924 GAGCTTTTCTTTAAAAAAAAAGG + Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006097813 6:31666628-31666650 ATGTTTAACTTCAAAGAAAAGGG + Intronic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1006526414 6:34609479-34609501 GAGCCTATCTCAAAAAAAAAAGG + Intronic
1006537041 6:34708037-34708059 ATGCTTAACTTTTAAAGAAATGG - Intergenic
1006699364 6:35959278-35959300 AGGCTTGACTGAAAAAAAAAAGG - Intronic
1007868247 6:45000266-45000288 ATACTTAACATAAAAGAAAAAGG - Intronic
1008889364 6:56468685-56468707 ATGCTCATATTATAAAAAATGGG + Intronic
1008922221 6:56854242-56854264 TTGCTTTTCTTAAAACAAAAGGG - Intronic
1009515410 6:64609940-64609962 TTATTTATCTTAAAAATAAATGG + Intronic
1009561318 6:65247927-65247949 TTGCTTATTTTGGAAAAAAATGG + Intronic
1009591895 6:65683637-65683659 GTACTTATCTTAATAAAACATGG - Intronic
1009685686 6:66953603-66953625 ATGCTTTTACTAAATAAAAAGGG - Intergenic
1009764602 6:68055733-68055755 ATTCCTATATTAAAAAAAAAAGG - Intergenic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1009814723 6:68717606-68717628 ATGAAATTCTTAAAAAAAAATGG - Intronic
1009839126 6:69044113-69044135 ATGCTTACCCTAAAAAATCAGGG + Intronic
1009909954 6:69913743-69913765 ATTCATATTTTAAAAAAAAGTGG + Intronic
1009918873 6:70031235-70031257 TTGCTCAAATTAAAAAAAAAAGG - Intronic
1009962998 6:70546432-70546454 AGGCTTTGCTTAAATAAAAAAGG - Intronic
1010100447 6:72099505-72099527 ATGTTTATAATAAATAAAAATGG - Intronic
1010456276 6:76059401-76059423 ATTTTTCACTTAAAAAAAAAAGG - Intronic
1010542148 6:77104555-77104577 AGGCTTATCATGAAAAAAGATGG - Intergenic
1010545163 6:77145372-77145394 ATGCATTTTTTAAAAAGAAAAGG + Intergenic
1010601466 6:77833140-77833162 ATGCTGCTACTAAAAAAAAAAGG - Intronic
1010722656 6:79301397-79301419 ATGCTTAAATTAAGATAAAAAGG + Intergenic
1010767833 6:79796377-79796399 ATTCTTATCTCAAAAGACAAAGG + Intergenic
1010924629 6:81729312-81729334 ATACTCAGATTAAAAAAAAAGGG - Intronic
1011546032 6:88482269-88482291 ATTCTTATTTTAAAAAAATTAGG - Intergenic
1011608333 6:89126383-89126405 AGACCTGTCTTAAAAAAAAAAGG + Intergenic
1011947838 6:92929085-92929107 ATGGTGATGTAAAAAAAAAATGG + Intergenic
1012494179 6:99816080-99816102 AAGTTTATTTTAAAAAAATAAGG - Intergenic
1012508671 6:99977728-99977750 ATTCTTATCCTTTAAAAAAAAGG + Intronic
1012524259 6:100158233-100158255 ATGCATATTGTAAAAAAAAATGG + Intergenic
1012558753 6:100551432-100551454 ATGATTTTTTTAAAAGAAAAAGG + Intronic
1012652596 6:101775093-101775115 ATGTTTATCTTACACAAATACGG - Intronic
1012785466 6:103619834-103619856 ATGCTTATATGAAAATAAACTGG + Intergenic
1012790461 6:103687550-103687572 ATGCCTAAATTAAAAAAATAGGG + Intergenic
1013142700 6:107354757-107354779 ATCCTTACCTTAAAAAAAGCTGG + Intronic
1013203986 6:107930305-107930327 ATTTTTATTTTAAAAAAAAAAGG + Intronic
1013675517 6:112457141-112457163 ATGCCTGTTTTAAAAAAAATAGG + Intergenic
1013685118 6:112571926-112571948 TTTCTCATCTAAAAAAAAAATGG - Intergenic
1013764087 6:113553988-113554010 AACTTTATTTTAAAAAAAAATGG + Intergenic
1013919465 6:115384542-115384564 ATGCATATCTTTATAAAGAAAGG - Intergenic
1013986701 6:116202272-116202294 ATGCTAAGCATAAGAAAAAAAGG - Intronic
1014119565 6:117707981-117708003 ATGTTTATTTTAAATAAAAATGG - Exonic
1014777727 6:125529612-125529634 ATGCAGAGGTTAAAAAAAAATGG + Intergenic
1014860390 6:126459918-126459940 AGGCTTTCCTTAAAAAAAAAAGG - Intergenic
1014915290 6:127139602-127139624 TTTCTAACCTTAAAAAAAAATGG + Intronic
1015138544 6:129902564-129902586 GTGCTTATTAGAAAAAAAAAAGG - Intergenic
1015277041 6:131393851-131393873 AAGATTATTTTAAAAAATAATGG - Intergenic
1015350877 6:132217599-132217621 ATCTTACTCTTAAAAAAAAATGG + Intergenic
1015636771 6:135283833-135283855 ATGTTTATATGAAAAATAAAGGG - Exonic
1015762909 6:136684218-136684240 ATTTTTTTTTTAAAAAAAAAAGG + Intronic
1016080673 6:139851391-139851413 ATTCATTTCTTAAAAAAAGAAGG - Intergenic
1016167457 6:140964801-140964823 AGGCTTATATTTAAAAAGAAAGG - Intergenic
1016195576 6:141334387-141334409 ATGTTTATCTTTGAAGAAAAGGG - Intergenic
1016346911 6:143123819-143123841 ATGCTTATGTTAGATAAAGAAGG - Intronic
1016682514 6:146846668-146846690 AAGCCTATCTTAATAACAAAAGG - Intergenic
1016723356 6:147328576-147328598 ATGATCACATTAAAAAAAAATGG - Intronic
1016757677 6:147704546-147704568 ATGCAAATCAGAAAAAAAAAGGG + Intronic
1017111654 6:150938470-150938492 TTTCTTTGCTTAAAAAAAAAAGG - Intronic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1017454684 6:154590705-154590727 ATGATTATTTTAAAGGAAAATGG - Intergenic
1017516292 6:155158808-155158830 ATGTTTATCTTTAAATAATAAGG + Intronic
1017835175 6:158170615-158170637 ATCCATATCTTAAAAACAACAGG - Intronic
1018014874 6:159703005-159703027 AACCTCATCTTTAAAAAAAATGG + Intronic
1018517922 6:164608164-164608186 ATGTTTATATCAATAAAAAAGGG - Intergenic
1018781739 6:167074185-167074207 GTGCTTATATTAGAAAAGAAGGG + Intergenic
1019025221 6:168956378-168956400 ATGTTTATCTTTATAAGAAATGG - Intergenic
1020409944 7:7880835-7880857 TTTCTTCTCTTAAAGAAAAATGG + Intronic
1020457631 7:8392133-8392155 ATGCTTATCTTGTAAAAATCAGG - Intergenic
1020504236 7:8963165-8963187 ATTATCAACTTAAAAAAAAATGG - Intergenic
1020591065 7:10137962-10137984 ATGCATAGCTAAAAACAAAATGG + Intergenic
1020670548 7:11103296-11103318 AAGCTTATATTAAAACAATAAGG - Exonic
1020940916 7:14535883-14535905 TTGTTTATCTTAAAAAAAACAGG - Intronic
1021129874 7:16898951-16898973 ATACTAATCTTAAATATAAATGG - Intergenic
1021262137 7:18471537-18471559 ATGGTCAACTTAAACAAAAAAGG + Intronic
1021516031 7:21488256-21488278 ATTTGTATCTTAAAAAAACATGG - Intronic
1021552836 7:21889923-21889945 ATGGTTTTCTTAAAGTAAAAGGG + Intronic
1021658294 7:22893652-22893674 ATTCTTTTTTTAAAAAAAAATGG + Intergenic
1021771903 7:24011503-24011525 AAGCTTATTTAAAGAAAAAATGG + Intergenic
1021965866 7:25917267-25917289 ATTCATAGCTTAAAAAAAGAGGG - Intergenic
1022014775 7:26340002-26340024 ATCATTATTTAAAAAAAAAACGG - Intronic
1022408040 7:30110706-30110728 ATGGCTATATTAAAAACAAAAGG - Intronic
1022674215 7:32483215-32483237 ATTCTTAACTTACAAAAATAAGG - Intergenic
1022793280 7:33711010-33711032 ATTCTTTTTTTAAAAAAAAAAGG - Intergenic
1022965783 7:35469988-35470010 ATGCTTTTTTTCAGAAAAAAGGG - Intergenic
1023127252 7:36966821-36966843 ATGCATCTCTTAAATAAAACTGG - Intronic
1023210731 7:37802066-37802088 ATGCATATATTAGAAAAGAAGGG - Intronic
1023308557 7:38857234-38857256 ATATTTATCTTAACACAAAATGG + Intronic
1023514601 7:40988421-40988443 ACACCTACCTTAAAAAAAAATGG - Intergenic
1024144333 7:46497065-46497087 ATTATTATTTTAAAATAAAAAGG + Intergenic
1024155709 7:46621813-46621835 AGCCTTATATTAAAAAAATAAGG - Intergenic
1024184115 7:46931262-46931284 ATGTTTATATTAAATCAAAATGG + Intergenic
1024713848 7:52051310-52051332 ATAATTATCTTAAATATAAATGG - Intergenic
1024720236 7:52128648-52128670 ATGCTTATTGTAAAAAAGAGCGG + Intergenic
1024811203 7:53214446-53214468 AAGCTTATTTTAAAAAAAAATGG + Intergenic
1024879935 7:54073491-54073513 ATGCTTAAAATAAAATAAAAAGG - Intergenic
1024987847 7:55211224-55211246 TTACTTATCTTTAAAAAAAAAGG + Exonic
1025193917 7:56917951-56917973 ATCCTTATCTTACAGATAAAAGG + Intergenic
1025282195 7:57636218-57636240 GAGCTTATTTTACAAAAAAAAGG + Intergenic
1025291211 7:57726092-57726114 ATGCTTACCTTGAAAGAAAGAGG - Intergenic
1025302535 7:57829301-57829323 GAGCTTATTTTACAAAAAAAAGG - Intergenic
1025320628 7:58089581-58089603 CTGATGAGCTTAAAAAAAAAAGG + Intergenic
1026110624 7:67456251-67456273 GACCTTGTCTTAAAAAAAAAAGG + Intergenic
1026392451 7:69915354-69915376 CTGCTTATTTTTAAAAATAAAGG + Intronic
1026732347 7:72923123-72923145 AGACTTAACTTGAAAAAAAAAGG - Intronic
1027629710 7:80587646-80587668 AACCCTATCTGAAAAAAAAATGG + Intronic
1027640591 7:80728859-80728881 ATGCTTATTTTAAAGACAAAGGG - Intergenic
1027656272 7:80934524-80934546 ATGCATATCTTAAAAAAAACAGG + Intergenic
1027736763 7:81942222-81942244 CTGGTTATATTGAAAAAAAAAGG - Intergenic
1027848368 7:83415728-83415750 CTGCTTGACCTAAAAAAAAATGG - Intronic
1027941449 7:84686201-84686223 ACGGTGATCTTAAAAAGAAAGGG - Intergenic
1028386497 7:90259784-90259806 ATGTAAATGTTAAAAAAAAATGG - Intronic
1028522258 7:91744484-91744506 ATTCTTACTTTAAAAAAATATGG - Intronic
1028861884 7:95661709-95661731 ATACTTGTTTTAAAAAATAAAGG + Intergenic
1029206600 7:98872765-98872787 ATGCCCATTTTAAAGAAAAAGGG - Intergenic
1030058689 7:105606049-105606071 TTTCTTTTTTTAAAAAAAAAAGG - Exonic
1030405286 7:109103166-109103188 ATGCTTATATTAAAAAAGAAAGG - Intergenic
1030667071 7:112290493-112290515 ATGCTTTAATTAAAAAGAAAAGG + Intronic
1030685931 7:112487162-112487184 ATGCTTACATTGAAAAAAGAAGG + Intronic
1030938043 7:115610870-115610892 ATGATATTCTTAAAAAGAAAAGG - Intergenic
1031217229 7:118910552-118910574 ATGATTATTTTAAAAATTAAGGG + Intergenic
1031279590 7:119780914-119780936 ATGCTTAGCTTGAAATAAAAGGG + Intergenic
1031311809 7:120207940-120207962 ATACTAATCTTAAATATAAATGG + Intergenic
1032563489 7:132916585-132916607 ATGCCTTTTTTAAAAAGAAAAGG + Intronic
1032979588 7:137266634-137266656 ATGGTTATCTTCAAAAAAAAAGG - Intronic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033294276 7:140115884-140115906 ATTTTTATCATAAAAAAAAAAGG + Intronic
1033853743 7:145531244-145531266 ATGATTTTTTTTAAAAAAAAGGG - Intergenic
1033956899 7:146860557-146860579 ATATTTATCTGAAAGAAAAATGG + Intronic
1033999277 7:147391498-147391520 ATAGTTATCTTAAAAATGAATGG + Intronic
1034143076 7:148841180-148841202 AGGGTTAGCTTAAAAAAAAAAGG - Intronic
1034178276 7:149117597-149117619 ACACTTCTTTTAAAAAAAAAGGG + Intronic
1034301679 7:150021119-150021141 ATATTTTTTTTAAAAAAAAAAGG - Intergenic
1034515665 7:151576507-151576529 AACCTTGTCTCAAAAAAAAAAGG - Intronic
1034619103 7:152443713-152443735 AGACTTGTCTCAAAAAAAAAAGG - Intergenic
1034651204 7:152691942-152691964 ATGCTTACCTTAATAAATTATGG + Intergenic
1034951793 7:155302974-155302996 AAGCTTATATTTAAAAAAATAGG + Intronic
1035797566 8:2373214-2373236 ATGTATATCTTAAAAGGAAAAGG - Intergenic
1035839606 8:2796247-2796269 ATTCTTATTTAAAAAAAAAAAGG + Intergenic
1036131849 8:6122587-6122609 ATGCATTTGTTAAAAAAACAAGG + Intergenic
1036165456 8:6428788-6428810 AGGCTTATCATGAAAAACAATGG + Intronic
1036284259 8:7429927-7429949 ATTCTTGTCTGAAAAAAAAGTGG + Intronic
1036337217 8:7881603-7881625 ATTCTTGTCTGAAAAAAAAGTGG - Intronic
1036439658 8:8769847-8769869 AATCTTAAATTAAAAAAAAATGG - Intergenic
1036962231 8:13257206-13257228 ATGCTTATCATAAAAAAAAAAGG + Intronic
1036985785 8:13529127-13529149 ATGTTTTTCTTAAAATAAAATGG + Intergenic
1037652218 8:20849120-20849142 ATGCTTAGCTTCAACATAAAAGG - Intergenic
1038902728 8:31862112-31862134 ATGTTTATTTTTAAAAAACATGG + Intronic
1039320545 8:36425393-36425415 ATTATTATTTAAAAAAAAAAAGG + Intergenic
1039592175 8:38757894-38757916 ATGATGATCTCAGAAAAAAAGGG + Intronic
1039958426 8:42224975-42224997 AGGATTATTTTAATAAAAAAAGG - Intergenic
1040088966 8:43376226-43376248 ATTTTTATCCTAAAACAAAATGG + Intergenic
1040096682 8:43452014-43452036 AGTGTTATCTGAAAAAAAAATGG + Intergenic
1040456718 8:47605537-47605559 ATGCATATTTAAAAGAAAAATGG - Intronic
1040524156 8:48204080-48204102 TTTCTCATCTGAAAAAAAAATGG - Intergenic
1041427563 8:57739367-57739389 ATGCTGAATTTAAAAATAAATGG - Intergenic
1041576490 8:59402169-59402191 ATGCTTATATTAAAAAAATAAGG + Intergenic
1041593159 8:59615231-59615253 ATGCTTATCTTTAAAATAATTGG + Intergenic
1041861308 8:62516041-62516063 CTTCCTTTCTTAAAAAAAAATGG - Intronic
1041987480 8:63941374-63941396 ATGCCTATATTATGAAAAAAAGG - Intergenic
1042489737 8:69383301-69383323 ATACTAATCTTAAATATAAATGG + Intergenic
1042675555 8:71317792-71317814 AATCTTATCTCAAAAATAAAGGG + Intronic
1042843924 8:73151375-73151397 ATGCTTCTCTTAAAAAAGGAAGG - Intergenic
1043216506 8:77596905-77596927 AAGCTTATTTTAAAAAATGATGG + Intergenic
1043408528 8:79965991-79966013 ATCCTGATTTTAAAAAAGAAAGG + Intronic
1043451955 8:80376726-80376748 ATGCTAAGCTTAACAACAAAAGG - Intergenic
1043772369 8:84221257-84221279 AAGCTAATCTTATAAGAAAATGG + Intronic
1043939793 8:86184577-86184599 ATGCTTGGTTTAAAAATAAAAGG - Intergenic
1044159072 8:88889835-88889857 ATGCTTCTCTTAAGAAATTATGG + Intergenic
1044359733 8:91268425-91268447 ATACTTATTTTAAATAAAATAGG - Intronic
1044434549 8:92146702-92146724 AAGGTGATCTAAAAAAAAAAAGG - Intergenic
1044650699 8:94491304-94491326 ACTCTTGTCTCAAAAAAAAAAGG + Intronic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1044756174 8:95463726-95463748 ATGGGTATCTTTCAAAAAAATGG + Intergenic
1045910189 8:107398375-107398397 ATGCTTTTCTTGAAATAATAGGG - Intronic
1045922795 8:107551897-107551919 ATGATTACATTAAAAAAAAATGG - Intergenic
1046016558 8:108612222-108612244 ATTTCTATGTTAAAAAAAAATGG + Intronic
1046039824 8:108889233-108889255 ATGCTTTTCTTATAAAAAGTGGG - Intergenic
1046205481 8:110989876-110989898 ATACTTTTTTTAAAAAATAAGGG - Intergenic
1046923814 8:119765391-119765413 ACGCTGATCTTAGAAAAATAAGG + Intronic
1047553078 8:125897858-125897880 ATGCCTATCTTAAAGAGATATGG + Intergenic
1047557406 8:125947652-125947674 ATGAATAGCTTAAAAAAAAGAGG + Intergenic
1047860515 8:128961213-128961235 GTGCTTATCTGAAAAAAATGGGG - Intergenic
1047983323 8:130206245-130206267 AACCTTATCTTTTAAAAAAATGG - Intronic
1048358015 8:133669418-133669440 CTGCTCCTCTTAAAAAAAAATGG + Intergenic
1048484846 8:134837625-134837647 ATACTTAGTTAAAAAAAAAAAGG + Intergenic
1048487352 8:134860652-134860674 ATTATTTTCTTAAAATAAAAAGG - Intergenic
1048760641 8:137790828-137790850 ATGCTTATGATAAAAAGATAAGG + Intergenic
1048828298 8:138451254-138451276 TTGATCATCTTAAACAAAAAGGG - Intronic
1049017219 8:139929427-139929449 AGGCTTACAATAAAAAAAAAGGG + Intronic
1049864204 8:144923249-144923271 ATTTTTATTTTAAAAAAGAAAGG + Intergenic
1049956443 9:697371-697393 ATGTCAATCATAAAAAAAAATGG - Intronic
1050273015 9:3966435-3966457 AGCATTATCTGAAAAAAAAAAGG - Intronic
1050556595 9:6794733-6794755 ATAATATTCTTAAAAAAAAATGG + Intronic
1050576880 9:7005922-7005944 ATGCTTATCTTAGAATAATTTGG + Intronic
1050686794 9:8179895-8179917 ATGCTTAACTGAAAAGATAAGGG - Intergenic
1050699375 9:8320644-8320666 TCTCTAATCTTAAAAAAAAATGG + Intronic
1051088811 9:13382407-13382429 ATGCTCATTGAAAAAAAAAAAGG - Intergenic
1051370046 9:16351276-16351298 AATTTAATCTTAAAAAAAAAAGG + Intergenic
1051522089 9:18000700-18000722 TTGGTTATCTTGAACAAAAAAGG + Intergenic
1051936824 9:22452683-22452705 ATGACTATTTGAAAAAAAAATGG - Exonic
1051960246 9:22751840-22751862 ATGCTTATCTTACAGAAATATGG - Intergenic
1052085436 9:24259955-24259977 TTGATTATCTTCAAAATAAACGG + Intergenic
1052174262 9:25438240-25438262 ATGTTTACATTAGAAAAAAAAGG + Intergenic
1052285621 9:26781688-26781710 ATACTTTTTTTAAAAAATAAGGG + Intergenic
1052418881 9:28215479-28215501 ATGCTTTTTTTAAAATATAAAGG - Intronic
1052471094 9:28898583-28898605 ATATGTATTTTAAAAAAAAAGGG - Intergenic
1052666686 9:31503849-31503871 ATATTTATCTTAAAAATAACAGG - Intergenic
1052789114 9:32857958-32857980 ATAATTATCCAAAAAAAAAAAGG + Intergenic
1053424314 9:38001060-38001082 ATGCTTAAAATAAAGAAAAAAGG - Intronic
1053529465 9:38865451-38865473 CTGTTTAACTGAAAAAAAAATGG + Intergenic
1053675187 9:40418625-40418647 ATGCTGATGTTAAAAGATAATGG + Intergenic
1053924973 9:43044966-43044988 ATGCTGATGTTAAAAGATAATGG + Intergenic
1054165230 9:61719288-61719310 ATGCTTACCTTGAAAGAAAGAGG + Intergenic
1054288464 9:63257157-63257179 ATGCTGATGTTAAAAGATAATGG + Intergenic
1054386286 9:64558694-64558716 ATGCTGATGTTAAAAGATAATGG + Intergenic
1054509433 9:65957668-65957690 ATGCTGATGTTAAAAGATAATGG - Intergenic
1054737072 9:68764932-68764954 ATTTTTATTTTAAAAAAAAGTGG + Intronic
1054809407 9:69422852-69422874 ATTCTTATTTTAAAAATTAATGG - Intergenic
1055047927 9:71949834-71949856 ATGCTTATCTCTAAAAACAGAGG - Intronic
1055157999 9:73088233-73088255 ACACTTAAGTTAAAAAAAAAAGG + Intergenic
1055299046 9:74863887-74863909 ATGTTTTTTTAAAAAAAAAAAGG - Intronic
1055520559 9:77076565-77076587 ATGCTATTTTAAAAAAAAAATGG - Intergenic
1055538509 9:77275809-77275831 AATCTTATTTAAAAAAAAAAGGG - Intronic
1055560777 9:77519523-77519545 AAGCTTTTTTTAAAAAAAATTGG - Intronic
1055563469 9:77545019-77545041 TTGCTTATGTTGAAAAAGAAAGG + Intronic
1055600917 9:77917524-77917546 ATAATAAACTTAAAAAAAAAAGG + Intronic
1055765552 9:79659401-79659423 ATGGTTATCTAAAAAAAAAAGGG - Intronic
1055969587 9:81898507-81898529 ATGCTTAGCATATAAATAAATGG - Intergenic
1056303018 9:85261313-85261335 ATTCTTCCATTAAAAAAAAAGGG + Intergenic
1056409083 9:86307608-86307630 ATTCTTATTTTAAGACAAAATGG - Intronic
1056411362 9:86330780-86330802 ATGCTTAAATTCAAAAAGAAAGG - Intronic
1056413250 9:86353341-86353363 ATTTTTATTTTAAAAAAATAGGG - Intronic
1056583913 9:87915604-87915626 ATGTCTTTATTAAAAAAAAAAGG - Intergenic
1056991223 9:91413254-91413276 ACTCTTATCAAAAAAAAAAAAGG - Intronic
1058157819 9:101534571-101534593 ATGCTTATTATAAAATAAAATGG - Intronic
1058416165 9:104790921-104790943 ATGCTTTCCTTAACAAAAATAGG - Exonic
1058441746 9:105015117-105015139 AGGCATTTCTTAAAGAAAAAAGG - Intergenic
1058629091 9:106967823-106967845 ATGCTTATATAAACAAAATAAGG - Intronic
1059048125 9:110893049-110893071 ATTCTGATCTTAAAAAGAATAGG + Intronic
1059151182 9:111951019-111951041 GTGCATATCCTCAAAAAAAAAGG + Intergenic
1059246273 9:112852243-112852265 GACCCTATCTTAAAAAAAAAAGG + Intronic
1059695647 9:116727804-116727826 ATACTTATCTGAAGAAAAATGGG + Intronic
1059776393 9:117479601-117479623 ATGGTGGTCGTAAAAAAAAATGG - Intergenic
1059832066 9:118107432-118107454 ATGCTTTCCATAAAAAAACAGGG - Intergenic
1059924076 9:119188772-119188794 ATCCCCATCTTTAAAAAAAATGG + Intronic
1060042994 9:120317392-120317414 AAACTTCTCTTAATAAAAAATGG + Intergenic
1060069882 9:120536906-120536928 GTCATTATCTTAAAAAAATAGGG - Intronic
1060374155 9:123103570-123103592 ATATGTATATTAAAAAAAAAAGG - Exonic
1060721344 9:125981489-125981511 ATGTATTTCTTAAAAAAAAAAGG - Intergenic
1061651991 9:132058047-132058069 ATTCTTAACTTTAAAAAAATAGG - Intronic
1062604176 9:137336724-137336746 ATGCATATTTTAAGAAAACAAGG + Intronic
1185476702 X:419675-419697 ATTCTAACATTAAAAAAAAAAGG + Intergenic
1185864078 X:3607245-3607267 AACCTTTTCTTAAAAAAATATGG + Exonic
1185925839 X:4144916-4144938 ATGTATATTTTGAAAAAAAAAGG + Intergenic
1186016679 X:5203585-5203607 ATGCTTAACATAAAAATAAGAGG - Intergenic
1186215686 X:7298091-7298113 ATTCTTCTCTTGAAAAAAAAGGG + Intronic
1186663329 X:11692252-11692274 ATGCTTATATTAGAAAAGAAGGG - Intergenic
1186981664 X:14963727-14963749 ATTGTTCTCTAAAAAAAAAAGGG - Intergenic
1187116579 X:16358455-16358477 ATACATAAATTAAAAAAAAAAGG - Intergenic
1187434402 X:19253781-19253803 ATGTGTATCTTAAAAAGATAAGG - Intergenic
1187452986 X:19415068-19415090 TTCCTAATCTTAAAAAAAAATGG + Intronic
1187691575 X:21873878-21873900 ATGCTCATAATAACAAAAAAAGG - Intronic
1188193723 X:27204480-27204502 ATGCTTTCATTACAAAAAAAGGG - Intergenic
1188413692 X:29905651-29905673 ATTCTTATATTTGAAAAAAAGGG + Intronic
1188474243 X:30573519-30573541 ATGGTTAGATTAAAAAAAAGAGG - Intronic
1188682060 X:33021553-33021575 TTGCTTCTCTTAAAAACATAAGG + Intronic
1188731836 X:33657391-33657413 ATTCTTACCTTAAAAACCAATGG + Intergenic
1188803984 X:34564594-34564616 ATACTTATTTTAAAAAGACATGG - Intergenic
1189122741 X:38412513-38412535 AAACTTATCTTAAAAATTAATGG + Intronic
1189270547 X:39748511-39748533 GTCCTTATTTTAAAAAAAAAGGG + Intergenic
1189426643 X:40907745-40907767 ATGCTTAACTTAAAAAGAAATGG + Intergenic
1189541151 X:41991288-41991310 GTGTATATCTAAAAAAAAAAAGG + Intergenic
1189578203 X:42377947-42377969 ATACATTTCTTAATAAAAAATGG + Intergenic
1189636950 X:43021518-43021540 ATGATTAACTGAAAAAAAAAGGG + Intergenic
1189655461 X:43240104-43240126 ATGCTAGTCTTAAGAAGAAATGG - Intergenic
1189872175 X:45395433-45395455 AAGCATATTTTAAAAAATAATGG - Intergenic
1189922888 X:45920690-45920712 AAGCTTATCAGAAACAAAAAGGG - Intergenic
1189981580 X:46516009-46516031 ATGCTTATATTAGAAAAGAAGGG + Intronic
1190099544 X:47511611-47511633 ATGTTTATTTTAAATAAAAATGG + Intergenic
1191013133 X:55782077-55782099 ATGCTTCTCTTCAGAACAAAAGG - Intergenic
1191201170 X:57783578-57783600 ATTCATATCTCAAAAAAATACGG - Intergenic
1192277274 X:69646674-69646696 ATGCTAATCTTAAATGTAAATGG - Intronic
1192475653 X:71439772-71439794 ATAATTATCTCAAAATAAAAAGG - Intronic
1192487629 X:71543796-71543818 ACTCTTGTCTCAAAAAAAAAAGG - Intronic
1192580879 X:72280225-72280247 AAGCTTATCGGAGAAAAAAATGG + Intronic
1192833083 X:74770940-74770962 TTGCATATGTTAAAAAATAAAGG + Intronic
1192915768 X:75649549-75649571 ATATCTGTCTTAAAAAAAAAAGG - Intergenic
1193240666 X:79165522-79165544 AGGCTTATCCTCAAGAAAAAAGG + Intergenic
1193358952 X:80557480-80557502 AAGCTTATTTAAAAAAATAATGG + Intergenic
1193359610 X:80565217-80565239 ATGGTTTCCTTAAAAAAAAATGG + Intergenic
1193581505 X:83269400-83269422 GGGCATATATTAAAAAAAAAAGG + Intergenic
1193854627 X:86584564-86584586 GTGCTTATATTATAAAAGAAAGG - Intronic
1193859474 X:86646435-86646457 ATACTTTTATTTAAAAAAAATGG + Intronic
1194197325 X:90910918-90910940 GTGCTTATTTTAAGAAAGAATGG + Intergenic
1194222454 X:91211829-91211851 ATGATTATCTGAAGAAAAAAAGG + Intergenic
1194712485 X:97252522-97252544 ATTATTATCTTAATAAATAAAGG - Intronic
1194810161 X:98379625-98379647 ATGCTCAGCTTAATTAAAAATGG - Intergenic
1194951391 X:100130701-100130723 CTGCTTTTTTTAAAAAAACAAGG + Intergenic
1195231799 X:102857722-102857744 ATGCTAATCTTGAATATAAATGG - Intergenic
1195239968 X:102941255-102941277 ATACTTATCTTCAAAAGATAAGG + Intergenic
1195314242 X:103662560-103662582 ATGGTTAGTGTAAAAAAAAAAGG - Intergenic
1195769676 X:108337063-108337085 ATGCTAATTTTAAAATAAAGTGG - Intronic
1195937599 X:110140416-110140438 AAGTTTTTCTTAAAGAAAAAAGG + Intronic
1196029810 X:111084630-111084652 CTGCTTAACTAGAAAAAAAATGG - Intronic
1196091774 X:111751714-111751736 AAGCTGATTTTAAAAAAAAATGG + Intronic
1196217876 X:113075914-113075936 ATGATTATCTAAAAAAATTAAGG - Intergenic
1196328999 X:114446042-114446064 ATGCTTATGTTGGAAAGAAACGG - Intergenic
1196537736 X:116867589-116867611 ATGTTTATCTTAAATATAAATGG - Intergenic
1197021413 X:121694287-121694309 GTGATTATTTTAAGAAAAAATGG - Intergenic
1197048108 X:122025110-122025132 ATGATTCTCTTAAGTAAAAATGG + Intergenic
1197065422 X:122227906-122227928 ATGGTTCTGTTAGAAAAAAAGGG + Intergenic
1197065476 X:122228444-122228466 ATGCTCAGCTTAATTAAAAATGG + Intergenic
1197312940 X:124928644-124928666 ATGTTTAACATAAAAAACAACGG + Intronic
1197348477 X:125352719-125352741 AAGCTTTTGTTAAAAAAAAAAGG + Intergenic
1197789173 X:130233972-130233994 AGACTTTTTTTAAAAAAAAAAGG + Intronic
1198111186 X:133503856-133503878 ACTCTCATCTCAAAAAAAAAAGG - Intergenic
1198170975 X:134104908-134104930 ATGTTTATTTTAACAAAAATTGG + Intergenic
1198786394 X:140292920-140292942 ATGATGATCTAAAAAGAAAAAGG + Intergenic
1198864062 X:141102241-141102263 AGTTTTATCTTAAAATAAAAAGG + Intergenic
1198898627 X:141485174-141485196 AGTTTTATCTTAAAATAAAAAGG - Intergenic
1199700089 X:150369138-150369160 ATCAGAATCTTAAAAAAAAAGGG - Intronic
1199825913 X:151498983-151499005 ATGCTTATGTGGGAAAAAAAAGG + Intergenic
1200355425 X:155544847-155544869 AGGCTAATCTTAAAAATAAATGG + Intronic
1200435028 Y:3141189-3141211 ATTCTTACCTTAAATAAAGATGG + Intergenic
1200544393 Y:4501875-4501897 GTGCTTATTTTAAGAAAGAATGG - Intergenic
1200558980 Y:4675603-4675625 ACGATTATCTGAAGAAAAAAAGG + Intergenic
1200644789 Y:5768077-5768099 ATCCTTATCACAAAAAAAGAGGG - Intergenic
1200688937 Y:6286169-6286191 AGTTTTATCTTAAAATAAAAAGG + Intergenic
1200840869 Y:7780521-7780543 TTGCTAAGTTTAAAAAAAAAAGG + Intergenic
1200972213 Y:9164743-9164765 TTGCTTACCACAAAAAAAAAGGG + Intergenic
1201013126 Y:9569821-9569843 AGTTTTATCTTAAAATAAAAAGG + Intergenic
1201046335 Y:9888551-9888573 AGTTTTATCTTAAAATAAAAAGG - Intergenic
1201577245 Y:15474318-15474340 ATGCAAATGATAAAAAAAAATGG + Intergenic
1202328084 Y:23713905-23713927 TTGCTTAATTAAAAAAAAAAAGG - Intergenic
1202542686 Y:25956147-25956169 TTGCTTAATTAAAAAAAAAAAGG + Intergenic