ID: 918037799

View in Genome Browser
Species Human (GRCh38)
Location 1:180892851-180892873
Sequence TGCTATTGCAGTACTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918037799_918037803 -3 Left 918037799 1:180892851-180892873 CCCTCACCAGTACTGCAATAGCA No data
Right 918037803 1:180892871-180892893 GCAGGTGCTTCTTCATTCTGTGG No data
918037799_918037804 15 Left 918037799 1:180892851-180892873 CCCTCACCAGTACTGCAATAGCA No data
Right 918037804 1:180892889-180892911 TGTGGACTTTGTTTTATCCCAGG No data
918037799_918037805 16 Left 918037799 1:180892851-180892873 CCCTCACCAGTACTGCAATAGCA No data
Right 918037805 1:180892890-180892912 GTGGACTTTGTTTTATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918037799 Original CRISPR TGCTATTGCAGTACTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr