ID: 918038250

View in Genome Browser
Species Human (GRCh38)
Location 1:180896195-180896217
Sequence CAGATCAGGGATAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918038244_918038250 -4 Left 918038244 1:180896176-180896198 CCCAGATGGTCAGAAAAAACAGA No data
Right 918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG No data
918038243_918038250 1 Left 918038243 1:180896171-180896193 CCTGGCCCAGATGGTCAGAAAAA No data
Right 918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG No data
918038245_918038250 -5 Left 918038245 1:180896177-180896199 CCAGATGGTCAGAAAAAACAGAT No data
Right 918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918038250 Original CRISPR CAGATCAGGGATAAGGAGGC TGG Intergenic
No off target data available for this crispr