ID: 918039339

View in Genome Browser
Species Human (GRCh38)
Location 1:180903117-180903139
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918039336_918039339 17 Left 918039336 1:180903077-180903099 CCTGAGACTGGGTAACTTATAAA 0: 252
1: 7046
2: 13726
3: 14691
4: 11996
Right 918039339 1:180903117-180903139 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918039339 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intergenic
Too many off-targets to display for this crispr