ID: 918040068

View in Genome Browser
Species Human (GRCh38)
Location 1:180908519-180908541
Sequence TGGAAACCTGCATTTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918040068_918040072 -3 Left 918040068 1:180908519-180908541 CCACCAGGAAATGCAGGTTTCCA No data
Right 918040072 1:180908539-180908561 CCATTTGGACAAGCTCCTTTAGG No data
918040068_918040073 1 Left 918040068 1:180908519-180908541 CCACCAGGAAATGCAGGTTTCCA No data
Right 918040073 1:180908543-180908565 TTGGACAAGCTCCTTTAGGCTGG No data
918040068_918040074 11 Left 918040068 1:180908519-180908541 CCACCAGGAAATGCAGGTTTCCA No data
Right 918040074 1:180908553-180908575 TCCTTTAGGCTGGACAGTCGAGG No data
918040068_918040076 12 Left 918040068 1:180908519-180908541 CCACCAGGAAATGCAGGTTTCCA No data
Right 918040076 1:180908554-180908576 CCTTTAGGCTGGACAGTCGAGGG No data
918040068_918040077 16 Left 918040068 1:180908519-180908541 CCACCAGGAAATGCAGGTTTCCA No data
Right 918040077 1:180908558-180908580 TAGGCTGGACAGTCGAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918040068 Original CRISPR TGGAAACCTGCATTTCCTGG TGG (reversed) Intergenic
No off target data available for this crispr