ID: 918041360

View in Genome Browser
Species Human (GRCh38)
Location 1:180916082-180916104
Sequence TTGGGGCCCCGGGAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918041350_918041360 19 Left 918041350 1:180916040-180916062 CCAGGTTACTTTCATCTGGACAG 0: 1
1: 0
2: 0
3: 5
4: 140
Right 918041360 1:180916082-180916104 TTGGGGCCCCGGGAGGTTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918041360 Original CRISPR TTGGGGCCCCGGGAGGTTGT GGG Intronic
900136015 1:1117176-1117198 CTGGGGGCCTGGGAGGTTGGGGG - Intergenic
900203710 1:1422163-1422185 TTGGGGACCTGGGAGGCTGAAGG - Intergenic
900520939 1:3105239-3105261 TTTGGGCCCAGGGAGGCTGGTGG - Intronic
900605939 1:3523565-3523587 TTGGGGAGCCTGGAGGGTGTGGG - Intronic
901501880 1:9657565-9657587 CTGGGACCCCAGGAGGTTGGGGG - Intronic
901808600 1:11752926-11752948 TGGGAGCCCCTGGAGGGTGTTGG + Intronic
903892789 1:26581131-26581153 TTGGGTCCCCAGGAGTTAGTGGG - Intergenic
904463947 1:30697040-30697062 TTGGGGCCCCGGGAGGATGGAGG - Intergenic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
905541588 1:38764497-38764519 TGGGGGCCCCGTGAGGTCTTGGG - Intergenic
905670099 1:39785749-39785771 TGGAGGCCCCTGGAGGTTGGTGG - Intronic
905964656 1:42081659-42081681 TTTGGCCCCCGGCAGGGTGTTGG + Intergenic
907915976 1:58870467-58870489 TTGGGCCCCCGGGAGGAAGGGGG + Intergenic
908253878 1:62286752-62286774 CTGGGGCCCCAGGAGGGGGTAGG - Intronic
911188320 1:94925749-94925771 TTGGGCTCCCGGGAGGTTAATGG + Intronic
912502713 1:110132853-110132875 TTGGGGCCCAGAGAGGTTAAGGG + Intergenic
913164925 1:116176348-116176370 TTGGGGTCAAGGGAGGTTTTGGG + Intergenic
915074565 1:153297789-153297811 TGGGGGCTCCTGGAGGATGTTGG + Intergenic
916039599 1:160950860-160950882 TTAGGGCCCTGGGTGGTGGTGGG - Intronic
918041360 1:180916082-180916104 TTGGGGCCCCGGGAGGTTGTGGG + Intronic
919832600 1:201552555-201552577 TTGAGGCTCAGGGAGGTTGTAGG - Intergenic
920846296 1:209595689-209595711 TTGAGGCCCAGGGAGCTCGTGGG + Intronic
1066015112 10:31233396-31233418 TTGGGGCCCCAAGTGGTTGGAGG - Intergenic
1067467059 10:46508975-46508997 GTGGGGCCCAGAGAGGATGTTGG - Intergenic
1067620127 10:47875630-47875652 GTGGGGCCCAGAGAGGATGTTGG + Intergenic
1069820191 10:71222770-71222792 TTGGGGCCTCTGGGGGTTGCAGG - Intronic
1069878866 10:71579509-71579531 TAGGAGCCCCGGGAGATTCTTGG - Intronic
1073088613 10:100913018-100913040 CTGGGACTCCGGGAGGCTGTCGG - Exonic
1073185624 10:101613666-101613688 TTGGGGAGAAGGGAGGTTGTGGG - Intronic
1074460475 10:113632230-113632252 TTGAGGCCCCAAGAGGTTATTGG - Intronic
1075406982 10:122201562-122201584 TTGGGGCCCTGCCAGGTTGGTGG - Intronic
1076739815 10:132477634-132477656 CTGGGGCCCCTGGAGGTGGGCGG - Intergenic
1076846481 10:133071817-133071839 TGGGGGCCTCGGGAAGCTGTGGG + Intronic
1077243365 11:1523709-1523731 CTGGGGCCCCAGGAAGGTGTTGG - Intergenic
1077473440 11:2775534-2775556 CTGGGGCCCAGGTAGGTAGTGGG + Intronic
1077505903 11:2929840-2929862 TTGGGGCGCCTGGAGGGTGAAGG - Intergenic
1077555715 11:3225230-3225252 TCAGGGCCCAGGGAGGCTGTGGG - Intergenic
1080838814 11:35965480-35965502 TGGGGGCCATGGGAGGGTGTAGG + Intronic
1083031169 11:59593847-59593869 TTGGAGACCCTGGAGGTTCTGGG - Intronic
1086962438 11:92992466-92992488 ATGGAGCCCCGGGAGGGTGAAGG - Intergenic
1090866111 11:130702247-130702269 TAGGGGAACAGGGAGGTTGTGGG - Intronic
1096101768 12:48973999-48974021 TGGGGGCCCCTGGAGATTGGGGG + Intergenic
1096111627 12:49032237-49032259 TTGGGGGCCCAGAAGGTTCTGGG + Exonic
1104952789 12:132449832-132449854 CTGGGGCCCCCGGAGGTTGGTGG - Intergenic
1105302947 13:19151822-19151844 CTGGGCCCCAGGGAGGTAGTGGG - Intergenic
1107086611 13:36432545-36432567 TTGGGGTCCAGGCAGGTTTTGGG + Exonic
1110019096 13:70446357-70446379 TTTGGGCACTGGGAGGTTTTGGG + Intergenic
1113569482 13:111343562-111343584 TGGGGGCCCTTGGAGGTTGCCGG + Intronic
1114769055 14:25408172-25408194 TTGGGGCCACTGCAGGATGTTGG + Intergenic
1116845711 14:49863018-49863040 TTGGGACCCCGGAAGCTTATCGG + Intergenic
1119558148 14:75569075-75569097 TCGGGGCCCAGGGAGGCTGATGG + Intergenic
1122302615 14:100739525-100739547 TCGGGGCCCCGGGTGGGTGAGGG - Intergenic
1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG + Intergenic
1123003919 14:105312347-105312369 CCGGGGTCCCCGGAGGTTGTGGG - Exonic
1202834106 14_GL000009v2_random:65153-65175 TGGGGGCACCGGGAGGGTGGGGG + Intergenic
1126206626 15:46053130-46053152 TAGGGGCCCTGGGAGGAGGTGGG + Intergenic
1130485710 15:84397263-84397285 GTTGGGCACCGGGAGGTGGTGGG - Intergenic
1132802839 16:1762738-1762760 TGGGGGCCCCTGGGGGATGTGGG + Intronic
1136139390 16:28278894-28278916 TTTGGGCACAGGGAGGTTGATGG - Intergenic
1137551843 16:49442862-49442884 TGGGGGACCCGGCAGGTAGTGGG - Intergenic
1140044476 16:71431603-71431625 TTGGGCCCCCGGGAAGTTTCAGG + Intergenic
1141558834 16:84853566-84853588 CTGGGGCCGCGGGAAGTTCTAGG + Intronic
1141812220 16:86383252-86383274 CTGGGGAGCCGGGAGGATGTGGG - Intergenic
1142201669 16:88763999-88764021 TTTGGCCCCCAGGAGGCTGTGGG - Intronic
1142867233 17:2798396-2798418 TTGGGGCCCCTTGAGGTTGACGG + Intronic
1144670145 17:17128245-17128267 CTGGGTCCCAGGGAGGGTGTGGG + Intronic
1145867546 17:28250578-28250600 CTGGGGCCCCAGGAGGTTGGTGG + Intergenic
1147186809 17:38717507-38717529 TGGGGGCCCCAGGAGGCTGGAGG - Exonic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1147870162 17:43581602-43581624 GTGGGGCTACGGGAGGGTGTGGG + Intergenic
1147915552 17:43883209-43883231 GTGGGGCTCCTGGAGGATGTGGG + Exonic
1147924584 17:43938688-43938710 CTGGGGCCCCGGGAGGAGGTCGG - Exonic
1147965854 17:44193864-44193886 GTGGCGACCCGGGAGGCTGTGGG - Exonic
1148142635 17:45339287-45339309 TTGGGGCCCCGTGAAAATGTTGG - Intergenic
1151674494 17:75590571-75590593 TTGTGGCTGCAGGAGGTTGTGGG - Intergenic
1151814729 17:76466211-76466233 TGGGGGACCCTGGAGGTTGAAGG + Exonic
1152321253 17:79609912-79609934 TGGTGGCCCCGGGCGGTGGTGGG - Intergenic
1155651979 18:28153544-28153566 TTAGGGCCCCGGGGGGTTGGGGG - Intronic
1161399207 19:4060037-4060059 ATGGGGCCCCGGGTGGGTGTGGG - Intronic
1162954805 19:14091794-14091816 GTGGGGCCCCGGGTGGGTGCGGG - Exonic
1165094948 19:33405210-33405232 ATGGGGCCCAGGGAGGGTCTGGG - Intronic
1165736962 19:38183101-38183123 TTTGGGCCAGGGGAGGGTGTGGG + Intronic
1165969164 19:39611131-39611153 TTTGGGACCCAGGAGGTTTTTGG + Intergenic
1167445869 19:49537233-49537255 CTGGGTCCCCGGAAGGGTGTGGG - Intronic
1167467527 19:49658158-49658180 ATGGGGCCCCGGGAGCCTGGTGG + Intronic
1168249606 19:55134228-55134250 CTTGGGCCCAGAGAGGTTGTGGG + Intronic
1202638575 1_KI270706v1_random:62539-62561 TGGGGGCACCGGGAGGGTGGGGG - Intergenic
925293349 2:2762762-2762784 GTGGGGCCCAGAGAGGCTGTAGG - Intergenic
925757921 2:7151787-7151809 TTGAGGCCCCTGGCGGTTGTTGG + Intergenic
926820918 2:16851062-16851084 TTGGGGGGCAGGGGGGTTGTGGG - Intergenic
927717058 2:25359808-25359830 GTGGGCCCCTGGGAGGTTGGGGG + Intergenic
927847564 2:26479416-26479438 TGGGGGCCCAGGGAGGTGGGAGG + Intronic
927879561 2:26681104-26681126 CTGGGACCCCAGGAGGTAGTTGG - Intergenic
928105630 2:28468912-28468934 TGGGGGCTCCGGGAGGCTGCTGG + Intronic
942122553 2:172792546-172792568 TGGGAGGCCAGGGAGGTTGTGGG + Intronic
942580526 2:177411964-177411986 TTGGGGCCCTGGCAAGTTGGTGG + Intronic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
948600325 2:239104194-239104216 TTGGGGCCCTGGGCGGCTGCGGG + Intronic
948757316 2:240167212-240167234 TTGGGGACTTGGGAGGTTCTCGG + Intergenic
1170407264 20:16051127-16051149 TTGGAACCCGGGGAGGCTGTGGG - Exonic
1172155410 20:32820337-32820359 GTTGGGCCCTGGGAGGGTGTGGG + Intronic
1172763425 20:37337565-37337587 GTGGGGCACAGGGAGGTTGCAGG + Intergenic
1173095884 20:40027792-40027814 TTGGGGACTCGGGAGGGGGTTGG - Intergenic
1176896423 21:14383669-14383691 CTGGGGCTCCGGGAGGCTATAGG - Intergenic
1180157870 21:45986766-45986788 TTTGGTCCTCGGGAGGGTGTGGG + Intronic
1180363391 22:11919349-11919371 TGGGGGCACCGGGAGGGTGGGGG + Intergenic
1182331779 22:29556044-29556066 GTGGGGCCAGGGGAGGTTGTTGG - Intronic
1183520347 22:38293192-38293214 CTGGGGCCCTGGGAGCTTCTAGG + Intronic
1183948137 22:41338389-41338411 TTGGGGCCCCGAGAGGTCAGGGG + Intronic
1184469808 22:44690094-44690116 CTGGGGCCCAAGGAGGATGTGGG + Intronic
1184900222 22:47442128-47442150 TGGGGGGCCTGGGATGTTGTCGG - Intergenic
1185382404 22:50515984-50516006 CTGGGGCTCCGGGAGGCTGAGGG + Intronic
950555792 3:13695216-13695238 TGGGAGCCACGGGAGGTTGAGGG + Intergenic
951317392 3:21203951-21203973 TTGAGGCCCCTGTAGGTTGAGGG + Intergenic
962318050 3:134371011-134371033 GTGGGGCCCCGGGAGGCAGTCGG - Exonic
965055346 3:163705867-163705889 TTGGGTCCCCTGGAGGGTGAAGG + Intergenic
966940163 3:184741115-184741137 CTGGGGCTCCTGGAGGTTGTGGG - Intergenic
966958881 3:184913228-184913250 TTGGGGCCAAGGGAAGGTGTAGG - Intronic
968700052 4:2051449-2051471 TTTGGGCCCCTGGAGGCTATGGG + Intergenic
968999754 4:3970634-3970656 TTGGGGCCCCAGCAGGCTGGAGG - Intergenic
982114078 4:152082614-152082636 GTGGGGTCCCGGGAGGGAGTGGG + Intergenic
1202765914 4_GL000008v2_random:148398-148420 TGGGGGCACCGGGAGGGTGGGGG - Intergenic
985751600 5:1681813-1681835 TTGGGTCCCTGGGAGTATGTGGG + Intergenic
987797065 5:22641410-22641432 TTGGGGCCCCAAGTGGTTGATGG + Intronic
992080746 5:73233135-73233157 GTTGGGCCCCCGGAGGTTGGAGG + Intergenic
999374719 5:151078975-151078997 TCGGGGCCCCAGGAAGCTGTGGG - Intronic
1000621151 5:163488549-163488571 TTGGGGTCTGGGGAGGTAGTGGG - Intronic
1001495729 5:172186928-172186950 TTGGGGCTCCTGTAGCTTGTAGG - Intronic
1001595851 5:172898325-172898347 TTGAGGCCCAGGGAGGTGGAGGG + Intronic
1002135320 5:177104084-177104106 GTGTGTCCCCGGGAGGTGGTAGG - Intergenic
1007757785 6:44111588-44111610 TGGGGGCACTGGGATGTTGTTGG - Intergenic
1013790014 6:113825853-113825875 TTGAGGCACCAGGATGTTGTAGG - Intergenic
1018412990 6:163574007-163574029 TTGGGGGCCGGGGCGGGTGTGGG + Exonic
1020282041 7:6654684-6654706 CTCGGGCCCCGGGAGGCTGAGGG + Exonic
1022942941 7:35257091-35257113 TTGGGGCCACAGGAGGGTATTGG + Intergenic
1024965684 7:55020210-55020232 TGGGGTCCCCGGGAGGTGGGGGG - Intronic
1028203690 7:87992334-87992356 TTGGGGCCTAGGGAAGGTGTTGG + Intronic
1028228435 7:88276724-88276746 TTTGGGAGCAGGGAGGTTGTGGG + Exonic
1029437749 7:100572486-100572508 GAGGGGCCCCGGGAGGGTGATGG + Exonic
1032361987 7:131264628-131264650 TTGGGTCCCCGGAGGGTTTTTGG + Intronic
1035774529 8:2177979-2178001 CTGGGGCCCAGGGAGGGTGGTGG + Intergenic
1040862043 8:52008844-52008866 TTGGGGCCCTTGGAGGTGATTGG + Intergenic
1045057477 8:98382087-98382109 TTGGGGACCTAGGAGGTGGTGGG + Intergenic
1047235870 8:123041805-123041827 TTTGGGCCCGGGGAGGCTCTGGG - Intronic
1047971927 8:130091994-130092016 TTGGGGGCCCATGAGGTAGTGGG + Exonic
1050388191 9:5111845-5111867 TCGGGAGCCCAGGAGGTTGTCGG - Intronic
1051568561 9:18528348-18528370 CTGGGGCCTGGGGAGGCTGTGGG - Intronic
1061637178 9:131919598-131919620 TTGGGACCCCAGGAGGTGGGTGG - Intronic
1062081094 9:134623794-134623816 GTGGGGCCTCGGCAGGTTGCTGG + Intergenic
1062354777 9:136156843-136156865 TCGGGGCCCCGGGGGGAGGTGGG - Intergenic
1062365238 9:136205188-136205210 GAGGGGCCCCGGGAGGTGGGCGG - Intergenic
1062541178 9:137042193-137042215 TTGGGGCCCCTGGACCTTGTGGG - Intronic
1203546665 Un_KI270743v1:133287-133309 TGGGGGCACCGGGAGGGTGGGGG - Intergenic
1185567736 X:1108603-1108625 TTGGGGCCCAGGGAGGGGGAAGG + Intergenic
1186365087 X:8884162-8884184 GAGGAGCACCGGGAGGTTGTAGG - Intergenic
1190304094 X:49072705-49072727 TTGGGGCCCAGGGTGGGTGGTGG - Intronic
1190988425 X:55521751-55521773 GTGGGGCCCCAGGAGGTGCTTGG + Intergenic
1197415930 X:126172731-126172753 TGTGGGCGGCGGGAGGTTGTGGG - Intergenic
1197488426 X:127084100-127084122 GTGGGGCCTGGGGAGGTAGTTGG - Intergenic
1198074788 X:133184113-133184135 TTAGGGTCCCTGAAGGTTGTGGG - Intergenic
1198827261 X:140712772-140712794 TTGGGGGCCCGGGAGAGGGTTGG - Intergenic
1199592802 X:149483426-149483448 TTAGGGCCCCACGAGGCTGTTGG + Intronic
1201447975 Y:14079258-14079280 TTGGGAACCCACGAGGTTGTAGG + Intergenic