ID: 918042542

View in Genome Browser
Species Human (GRCh38)
Location 1:180921992-180922014
Sequence CACAGCAATCAGGGCAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918042535_918042542 18 Left 918042535 1:180921951-180921973 CCGGTAACCTAGCGCAAGTGAAA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 122
918042538_918042542 11 Left 918042538 1:180921958-180921980 CCTAGCGCAAGTGAAAGGGTGTG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 122
918042533_918042542 28 Left 918042533 1:180921941-180921963 CCTTAGGATCCCGGTAACCTAGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 122
918042534_918042542 19 Left 918042534 1:180921950-180921972 CCCGGTAACCTAGCGCAAGTGAA 0: 1
1: 0
2: 0
3: 4
4: 38
Right 918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918042542 Original CRISPR CACAGCAATCAGGGCAACGC TGG Intronic
901185837 1:7372659-7372681 CAAAGCACTCATGGCAGCGCTGG - Intronic
901824745 1:11853750-11853772 CACAGAAGTCAGGACAACGTTGG - Intergenic
902128235 1:14235950-14235972 AAAAGCAGTCAGGGCAACGTGGG - Intergenic
903120257 1:21211923-21211945 CTCAGCACTCAGGCCAAGGCAGG + Intergenic
906091732 1:43185344-43185366 CAGAGAAATCAGGGTAAGGCGGG + Exonic
906517930 1:46450512-46450534 CACAGCAGGCAGGGCAGCTCAGG + Intergenic
910705873 1:90129065-90129087 CACAGCACTAAGTGCAACACTGG + Intergenic
912251314 1:108015165-108015187 GACAGGAATCAGAGCAACCCTGG + Intergenic
912633759 1:111271582-111271604 CTTAGGAATCAGGGCCACGCGGG - Intergenic
914745761 1:150499969-150499991 CAGACCAATCTGGGCAACACAGG + Intronic
916183469 1:162108233-162108255 AACAGCAAGCAGGGAAACTCTGG + Intronic
916608955 1:166371343-166371365 CAAAGCAATAAAGGCAAGGCTGG + Intergenic
918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG + Intronic
923272951 1:232373841-232373863 CACAGCACGCAGGGCCAAGCGGG + Intergenic
1069748555 10:70731556-70731578 CACAGGAATCATGGCAGTGCAGG - Intronic
1071514177 10:86286298-86286320 CACAGCACTCAGGTCAGTGCTGG - Intronic
1074832555 10:117259708-117259730 CTCAGGAATGAGGGCAACACTGG - Intronic
1075730022 10:124630526-124630548 CTCAGGAATCAGGGCAACACTGG + Intronic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1078476345 11:11633490-11633512 CACAGCAACCATGGCAGCTCTGG - Intergenic
1079305294 11:19316433-19316455 CACTGCAAGCAGCACAACGCTGG + Intergenic
1079736034 11:23998531-23998553 CAGAGCAATCAGGCCAAAGAAGG + Intergenic
1082010578 11:47447528-47447550 CACAGCAAACATGGCAGTGCAGG + Intronic
1084066719 11:66708436-66708458 AACAGGAAACAGGGCAGCGCTGG + Intronic
1086831172 11:91566007-91566029 CACTCCAATCTGGGCAACACGGG - Intergenic
1090139576 11:124241063-124241085 CACAGCAATCAGAGCTGCTCAGG + Intergenic
1092936311 12:13367277-13367299 CACAGCTAGCAGGTCGACGCAGG + Intergenic
1093980146 12:25467089-25467111 CACACCATTCAGGGCCACACAGG - Intronic
1095568432 12:43653986-43654008 CACAGCAATAAAGGCTGCGCTGG - Intergenic
1097510444 12:60531949-60531971 CACAGCAAGAAGGCCCACGCTGG + Intergenic
1098370448 12:69754070-69754092 CACAGCAACCAGGACAAGGGAGG + Intronic
1099710210 12:86214179-86214201 CACAGAAATGAGGGCAAGCCTGG - Intronic
1100521964 12:95383760-95383782 AACTGCAATCAGGGCATCCCTGG - Intergenic
1103310083 12:119998853-119998875 CAGACCAATCTGGGCAACACAGG + Intronic
1105401202 13:20097582-20097604 CACAGCCATCAGTGCAAATCTGG - Intergenic
1114672354 14:24418026-24418048 CACAGCTCTCAGGGCAGGGCTGG + Exonic
1115152871 14:30305531-30305553 CACAGCAATCAATCCAACTCTGG - Intergenic
1118493167 14:66281539-66281561 CACAGGAATTAAGGCAAGGCAGG + Intergenic
1120008885 14:79390740-79390762 CACAGCACTCAGGTAAACGCAGG - Intronic
1120204843 14:81576862-81576884 CACGGCAATAAGGGCATCCCAGG - Intergenic
1120912801 14:89682947-89682969 CACAGCAATGGGGGCATCACAGG + Intergenic
1122696244 14:103554086-103554108 CACACCACTCAGGGCCTCGCAGG + Intergenic
1122798597 14:104218584-104218606 CCCAGCCAGCAGGACAACGCGGG - Intergenic
1124662618 15:31562541-31562563 CACAGCATGCAGGGCCACACGGG - Intronic
1128084656 15:64877596-64877618 CCCAGCAATTTGGGCAAAGCTGG - Intronic
1128635082 15:69298083-69298105 CTCAGCAAACAAGGCAAGGCAGG + Intergenic
1129540376 15:76342951-76342973 CACAGCAGTGAGGCCAACCCCGG + Intergenic
1129925638 15:79361437-79361459 CACAGCAACCCGGGTAACTCAGG + Intronic
1133818307 16:9214815-9214837 CACAGCAATCAGGCCCATGGTGG - Intergenic
1137061292 16:35793553-35793575 CACAGCTATCTGGGAAAGGCAGG + Intergenic
1137581407 16:49635773-49635795 CACTGCACTCGGGGCAACGGAGG + Exonic
1137629285 16:49930930-49930952 CACATGAATCAGGGCAGGGCTGG + Intergenic
1137700381 16:50493758-50493780 TAGAGCAATGAGGGCAAGGCAGG - Intergenic
1142312931 16:89324315-89324337 CACAGCAGTCGGGGCGACGTGGG + Intronic
1143846832 17:9778598-9778620 CACAGCAAACAGGCCAGCACCGG - Intronic
1144678512 17:17177036-17177058 CACAGCCATCAGGACATGGCAGG - Intronic
1146661599 17:34668485-34668507 CACAGGACTCAGGGAAAGGCTGG - Intergenic
1148929784 17:51119406-51119428 CACAGAAATAACGCCAACGCAGG + Intronic
1152974364 18:199698-199720 CAGAGCCAACAGTGCAACGCAGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156445745 18:37235567-37235589 CTCAGCACTGAGGGCAAGGCAGG + Intergenic
1161627804 19:5337328-5337350 CACAGAAAGCAGGTGAACGCGGG + Intronic
1161785652 19:6323891-6323913 CACAGCATTCAGGGGAGAGCTGG + Intronic
1162034011 19:7929565-7929587 CACAGAAACCAGGGCAGTGCTGG - Intronic
1162956323 19:14100616-14100638 CAGAGCAAACAGGGCAACTTAGG - Intronic
1163494848 19:17640408-17640430 CACAGCAATCAGGTCTAGACTGG + Intronic
1166309092 19:41952275-41952297 CACTGCAATCTGGGCAACAGAGG - Intergenic
925141938 2:1557002-1557024 CCCATCACTCAGAGCAACGCAGG + Intergenic
931947300 2:67324559-67324581 TATAGCATTCAGGGCAAGGCAGG - Intergenic
933098023 2:78211856-78211878 CACAGGAATCAAGGCCACGTAGG + Intergenic
933789654 2:85873501-85873523 CACAGCACTCTGGGCACCACAGG + Intronic
935124893 2:100214635-100214657 CACCGCAATCCTGGGAACGCAGG - Intergenic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
937643423 2:124238883-124238905 CATAGCAACCATGGCAACCCTGG + Intronic
937861666 2:126716196-126716218 CAGTCCACTCAGGGCAACGCTGG + Intergenic
941945491 2:171092101-171092123 CACAGGAACCAGGGCAACCTTGG - Intronic
948161571 2:235829121-235829143 CAGAACAAACAGGGAAACGCAGG - Intronic
1171430009 20:25077128-25077150 GACAGCAAACAGGGCAACAAGGG + Intronic
1177320652 21:19515407-19515429 CTCAGCAAAAAGGGCAAAGCTGG + Intergenic
1180875462 22:19173113-19173135 CACAGCAGTGAGGACAAGGCTGG + Intergenic
1181499048 22:23305488-23305510 CAAAGCAAGCAGGGCAGTGCTGG + Intronic
1184442055 22:44523010-44523032 CCCAGGAAGCAGGGCAAGGCAGG - Intergenic
1184608386 22:45587201-45587223 CACTGCAGTCACAGCAACGCCGG - Intronic
1184646065 22:45896125-45896147 CACAGCCGTCAGGGCAGCGTTGG + Intergenic
1185241316 22:49749105-49749127 CACAGCACACAGGGCAGAGCTGG + Intergenic
954226854 3:49187475-49187497 CCCAGCAATCATGGCACCACAGG + Intronic
956188804 3:66588359-66588381 CACTGCAGTCAGAGCAACACGGG - Intergenic
962339240 3:134568168-134568190 CACAGAAATCAGGACAGCTCTGG - Intronic
968865623 4:3209486-3209508 CCCAGCAACCAGGGCAGGGCAGG - Intronic
969959190 4:10926010-10926032 CACAACAATCAGTACAAAGCAGG + Intergenic
972036907 4:34535168-34535190 CAAAGCAATGAGGGCAAGGCAGG - Intergenic
975379599 4:73683605-73683627 CACAGCAATCAGGGGAAGTTGGG + Intergenic
975574556 4:75849767-75849789 CACAGGAAGGAGGGCAACTCAGG + Intergenic
976396128 4:84557539-84557561 CACAGTAATAAGGGGAACACTGG + Intergenic
979426681 4:120575622-120575644 CACAGCAATCAGGCCAAAGAAGG + Intergenic
980997815 4:139797559-139797581 CAGAGCAGCCAGGGCATCGCTGG + Intronic
982427805 4:155286027-155286049 CTGAGCAAACAGGGCAATGCTGG - Intergenic
989241768 5:39210198-39210220 CATAGCAGACAGGGCATCGCTGG - Intronic
992915527 5:81448581-81448603 CACAGTACTCAGGGCAATTCTGG + Intronic
999256447 5:150212264-150212286 CACTGTAATCAGGGCCAGGCTGG - Intronic
1000981159 5:167818625-167818647 CACAGCACTCAGGGCAGTGAGGG + Intronic
1002333982 5:178465553-178465575 CACAGCACCCAGGGCAAGACTGG + Intronic
1006307818 6:33235250-33235272 CACCTCACTCAGGGGAACGCTGG - Intergenic
1007441984 6:41869674-41869696 CACACCAATCTGGGCAACAGAGG + Intronic
1011497285 6:87949285-87949307 CCCAGCCATCTGGGCAAGGCAGG - Intergenic
1011935744 6:92775601-92775623 CACAGCATTTAGGGAAACTCTGG - Intergenic
1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG + Intergenic
1016363154 6:143289437-143289459 CACAGCCATTAGGGGAAGGCAGG - Intronic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019917116 7:4140636-4140658 CACAGTAAACAGGGCAGGGCTGG - Intronic
1020501585 7:8929451-8929473 CACGGGAATCAGGGCAGCTCTGG - Intergenic
1021486398 7:21173032-21173054 TACAGCAATCAGTGCAAGGCGGG - Intergenic
1037167877 8:15853025-15853047 CAAAGCAGACAGGGCAAAGCCGG - Intergenic
1038427311 8:27472198-27472220 CACAGAATTCAGGGAAACACTGG - Intronic
1039748310 8:40453207-40453229 TACAGCCATCAGGCCAACCCAGG - Intergenic
1040643786 8:49373374-49373396 CATAGCAATCATGGCAAAGTGGG + Intergenic
1040838091 8:51753774-51753796 TACAGCAAACAGGGCAAAGGTGG + Intronic
1054790730 9:69254058-69254080 CAGAGCAACCAGGGCATCCCTGG - Intronic
1056232840 9:84564640-84564662 CACAGCAATCTTAGGAACGCCGG + Intergenic
1057144713 9:92749941-92749963 CACAGCAGTCTGGGCCAGGCTGG + Intronic
1057804518 9:98210842-98210864 CACTGCAAACAGGGAAAGGCTGG + Exonic
1060409565 9:123391060-123391082 CACAGCAGTGTGGGCAGCGCTGG - Intronic
1060569849 9:124628417-124628439 CACTGCAATCTGGGCCTCGCAGG + Intronic
1060875574 9:127081393-127081415 CTCATCAATCAGGGCAGTGCAGG - Intronic
1191065594 X:56343697-56343719 CAGAGCATGCAGGGAAACGCAGG - Intergenic
1195448898 X:104987205-104987227 CTCAGCAGTCAGGGCTACTCAGG + Intronic
1198963690 X:142206858-142206880 TGCAGCAATCAGGGCAGGGCGGG - Intergenic
1199903522 X:152201496-152201518 CACAGCAATAGGGGCAAGGAGGG - Intronic