ID: 918042998

View in Genome Browser
Species Human (GRCh38)
Location 1:180924496-180924518
Sequence CTCCACACAGATCCTTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918042995_918042998 13 Left 918042995 1:180924460-180924482 CCTCAGAAGTCAGCATCTTAGGC 0: 1
1: 0
2: 0
3: 16
4: 148
Right 918042998 1:180924496-180924518 CTCCACACAGATCCTTTTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918042998 Original CRISPR CTCCACACAGATCCTTTTGA AGG Intronic
901450312 1:9332618-9332640 TTACACACAGATGTTTTTGAGGG - Intronic
904769647 1:32873650-32873672 CTCCACAGAGACCCCCTTGAGGG + Intergenic
905609058 1:39332816-39332838 CTACAAACAGATCCTGTTCAGGG - Intronic
907410892 1:54282565-54282587 TTGCACACAGATCCTTTGGAAGG - Intronic
907601968 1:55781019-55781041 CTCCACACAGAAGCTTATCAAGG - Intergenic
908873418 1:68641504-68641526 CTCCACATAATTCCTTTTGTTGG + Intergenic
909200990 1:72689797-72689819 ATCCACACAGATCCTGTACAAGG - Intergenic
909628664 1:77748027-77748049 CTCCTCACTAATCCTTTTCATGG + Intronic
913118956 1:115722019-115722041 CTCCTCAGAGGTCCTTTGGATGG + Intronic
915497579 1:156292771-156292793 CTCCACACATTTCCCTTGGATGG - Exonic
916739267 1:167633983-167634005 CTCCATACAAAGCCTTTTGCAGG + Intronic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
917885320 1:179378546-179378568 ATCCACACATATCCTTCTAATGG - Intronic
917910177 1:179635779-179635801 CTCCACAAAGACCCCTATGAGGG - Exonic
918042998 1:180924496-180924518 CTCCACACAGATCCTTTTGAAGG + Intronic
918407606 1:184226120-184226142 CTCCACAGAGATCGATTTGAAGG + Intergenic
918773238 1:188591637-188591659 CTCATCACAAACCCTTTTGATGG - Intergenic
921700259 1:218261324-218261346 CTACTCACAGATCTTTATGAGGG - Intergenic
922153515 1:223023982-223024004 CCCTGCACAGATCCTATTGAAGG - Intergenic
1067746459 10:48940106-48940128 CTCAGCACAGGTCCTTTTCAAGG + Intronic
1068705895 10:60074976-60074998 CTACACATACATCCTTTTTAAGG + Exonic
1072543978 10:96420094-96420116 GTCACCACAGATCCTTTTGGGGG + Intronic
1079020210 11:16904286-16904308 CTCCAAACAGATTTTTTTCAGGG + Intronic
1083961702 11:66018299-66018321 CTCCCCAGAGATCCTTCTCATGG + Intronic
1087414119 11:97830862-97830884 ATCCACAAAGATACTATTGAAGG + Intergenic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1096715694 12:53489977-53489999 CTCCACCCAGCTCCTTCAGAAGG + Intronic
1097298471 12:57992795-57992817 CTGCACACAAATCATCTTGAAGG - Intergenic
1097908825 12:64947751-64947773 CTCCAGGCAGATCCATTTCAGGG - Intergenic
1098498614 12:71165595-71165617 CTCCACCCACATCCTGCTGATGG + Intronic
1098673936 12:73265902-73265924 CTCCACACAGATCTGTGTGTTGG - Intergenic
1098986768 12:77020576-77020598 TTCCACACAGATCCTTGGGCAGG - Intergenic
1103020088 12:117526741-117526763 CTTCCCACATATTCTTTTGAAGG + Intronic
1105081107 13:16119079-16119101 CTGCAGACAGATATTTTTGAGGG + Intergenic
1105082218 13:16136209-16136231 CTGCAGACAGATATTTTTGAGGG + Intergenic
1105083815 13:16160190-16160212 CTGCAGACAGATATTTTTGAGGG + Intergenic
1105794861 13:23841354-23841376 CTCCACACCTCTCCTTTTGCAGG + Exonic
1106288481 13:28338855-28338877 CTCCAGACTGAGCCCTTTGAGGG + Intronic
1107334278 13:39336950-39336972 TTCAACAAAGATCCTTTTAATGG + Intergenic
1108576578 13:51796434-51796456 CTCCATACAGATACACTTGACGG - Intronic
1109261672 13:60151760-60151782 CTCCACTCAGTCTCTTTTGAGGG - Intronic
1110752690 13:79133549-79133571 CTCTGCACAGATTCTTTGGATGG - Intergenic
1110959460 13:81603055-81603077 CTACACACATATGATTTTGAGGG + Intergenic
1112780740 13:102898034-102898056 AGCCACCCAGATCCTCTTGAGGG - Intergenic
1113848772 13:113406418-113406440 CTCCAGACAGATCCTGCTGGCGG - Intergenic
1113883400 13:113642382-113642404 CTGCCAACAGATCCTTTTCAAGG - Intergenic
1118153862 14:63219231-63219253 CACCACACAGAGCATTTTGAGGG + Intronic
1118346314 14:64943676-64943698 CTCCACACACTTCCTTCTGTGGG - Intronic
1119116934 14:72031979-72032001 CTCCACACTGCTCCTTTTCTGGG + Intronic
1119765635 14:77185853-77185875 CTCCACACAGAGCCACTGGAAGG + Intronic
1128182253 15:65614221-65614243 CTCCCCACATATTATTTTGATGG + Intronic
1128418424 15:67468019-67468041 CTCCACAAAGAACCACTTGAAGG + Intronic
1131904444 15:97127396-97127418 CTCCACACAGTTCCAATTGCAGG - Intergenic
1132120656 15:99172463-99172485 CTGCCCACAGATTCTTTTGGTGG + Intronic
1132346601 15:101112495-101112517 CTCCACACACATGCTTTCCAGGG + Intergenic
1133510066 16:6449573-6449595 CTGCACACAGAGCCTTATGATGG + Intronic
1137359280 16:47798096-47798118 CTCCAGACAGCTCCTTTAGCTGG + Intergenic
1137728370 16:50672201-50672223 CTCAACACTGCCCCTTTTGAGGG - Exonic
1138365015 16:56468275-56468297 CTACACACAACTCCTTTTCAGGG - Intronic
1139108101 16:63853215-63853237 CTCCACACCTTTCCTTTTGTGGG + Intergenic
1140785495 16:78337241-78337263 CTGCAGACAGAATCTTTTGAAGG + Intronic
1141552810 16:84817486-84817508 CTCCTTACAGATCCTTTGTATGG - Intergenic
1142548466 17:722342-722364 CTCTACACAGATCCTTTCCCTGG + Intergenic
1143173786 17:4945120-4945142 ACCCACACCTATCCTTTTGAGGG + Exonic
1145410105 17:22652506-22652528 CTACACAAAGATCCTTTAAAAGG + Intergenic
1145719970 17:27061783-27061805 AACCACACAGATCATCTTGAGGG - Intergenic
1145726735 17:27134527-27134549 CTGCACAGATATCCTTTTGTAGG - Intergenic
1148066512 17:44874577-44874599 CTCCTCACAGGCCCATTTGAGGG + Intronic
1149152343 17:53582786-53582808 CTCCTCATACATCCTTTTGTAGG - Intergenic
1149662319 17:58340834-58340856 CTCCACCCAGCTCATTTTGGGGG - Intergenic
1151664844 17:75540017-75540039 TCCCACACAGATCCTGTAGAAGG - Intronic
1153966958 18:10190916-10190938 TTCCATACAACTCCTTTTGAGGG - Intergenic
1156549293 18:37998666-37998688 CTTCACACAGATCATTTTTAGGG - Intergenic
1159251320 18:65880724-65880746 CTGCAGACATATGCTTTTGAAGG + Exonic
1159454432 18:68642767-68642789 CTTTGCACAGATCCTTTTAAAGG - Intergenic
1163178837 19:15584451-15584473 CCCCACCCAGATCCGATTGAGGG - Intergenic
1163584606 19:18156997-18157019 CTGCACACAGGGCCTTTTGCTGG - Intronic
1166298164 19:41898745-41898767 TTCAACACAGAGCATTTTGATGG + Intronic
1166419063 19:42620536-42620558 CTGCACTCAGATATTTTTGAAGG + Intronic
1166424866 19:42668731-42668753 CTGCACTCAGATATTTTTGAAGG - Intronic
1166437699 19:42783071-42783093 CTGCACTCAGATATTTTTGAAGG - Intronic
1166456514 19:42945328-42945350 CTGCACTCAGATATTTTTGAAGG + Intronic
1166466602 19:43037733-43037755 CTGCACTCAGATATTTTTGAAGG - Intronic
1166472740 19:43093820-43093842 CTGCACTCAGATATTTTTGAAGG - Intronic
1166493511 19:43280790-43280812 CTGCACTCAGATATTTTTGAAGG - Intergenic
926814457 2:16786369-16786391 CTCCACACAGCTGGTTTTGATGG - Intergenic
928417073 2:31104279-31104301 CTCCACACAAATCCTCTAGATGG + Intronic
928942222 2:36737852-36737874 CTCCACACAGATTGGTTTGTGGG + Intronic
929322227 2:40558077-40558099 TTCCACACAGGTCCTTGTAAAGG - Intronic
930758124 2:54999858-54999880 CTCTGCACAGATCCTTTTTGTGG - Intronic
932094167 2:68832182-68832204 ATTCACACAGAGTCTTTTGAAGG - Intergenic
936145720 2:109979575-109979597 CTCCCCACAGCTCCTGTGGAAGG + Intergenic
936198969 2:110391903-110391925 CTCCCCACAGCTCCTGTGGAAGG - Intergenic
937197736 2:120174746-120174768 TGCCACACAGAGCATTTTGAGGG - Intronic
938586318 2:132694002-132694024 CTCCAAACAGCTCCTGTTAATGG - Intronic
938665995 2:133538148-133538170 CTCCATGCAAACCCTTTTGAAGG + Intronic
938841408 2:135168480-135168502 CTAAACTCAGATGCTTTTGAAGG - Intronic
938980874 2:136525719-136525741 CTCCCCACTCCTCCTTTTGAGGG + Intergenic
939887828 2:147700598-147700620 CTGCACAAAGATCCAGTTGAAGG - Intergenic
941017732 2:160375829-160375851 CTCAACACAGAGCCTTGTGAAGG + Intronic
943747399 2:191476651-191476673 CAACACTCAGATCGTTTTGAGGG + Intergenic
945303359 2:208235192-208235214 CTCTACACAAATCCCCTTGAAGG - Intergenic
947816877 2:233043335-233043357 CTGCCCACAGCTCCTGTTGATGG + Intergenic
1169110556 20:3030379-3030401 ATCCACTCAGAAGCTTTTGAGGG - Intronic
1170946884 20:20899432-20899454 CTCCACACTGACCCTATTCAGGG - Intergenic
1171211238 20:23318600-23318622 CTCCACACAGCTCCCTGTGTGGG - Intergenic
1173259437 20:41420585-41420607 TTCCCCACATATCCTCTTGAAGG - Exonic
1174970806 20:55273539-55273561 CCCTACACAGATCCTTCTGTTGG - Intergenic
1180977171 22:19854808-19854830 CTCCACACTGACCCTCTTGCCGG + Exonic
1181069131 22:20321464-20321486 CTCCACACAGACACTCTTCATGG - Intergenic
1183014312 22:34973330-34973352 CTCCACACACAGCTTTTTGGAGG - Intergenic
949099284 3:124635-124657 CTGCACACAAATCCTTTTCTCGG + Intergenic
952103913 3:30047825-30047847 CTCAACAGAGTTCCTTTTAATGG - Intergenic
954101593 3:48377401-48377423 CACCACACAGATCTTTCTGGAGG - Intronic
956085009 3:65598814-65598836 CTCCACCCTGTTTCTTTTGAGGG + Intronic
956251055 3:67234326-67234348 CTCCCTGCAGATCATTTTGATGG - Intergenic
958945468 3:100357172-100357194 AACCTCACAGATCCTTTTAAAGG + Intergenic
959089060 3:101882950-101882972 CTCCACACAGTCCTTTTTGCAGG - Intergenic
962755603 3:138463517-138463539 TTCAACACAGTTCCTATTGATGG + Intronic
964430087 3:156596414-156596436 CTCAACACATATACTTTTGATGG - Intergenic
964907927 3:161741365-161741387 ATACACACAGATCCTTTCCAGGG + Intergenic
965180792 3:165400682-165400704 CTCCACACATATTCATTTCAAGG - Intergenic
967257601 3:187609435-187609457 CACCACAGAGATCCTTTGGGAGG - Intergenic
967947501 3:194815570-194815592 CTCCATACAGAATCTTATGACGG + Intergenic
970050615 4:11910496-11910518 CTCCACATAAAATCTTTTGATGG - Intergenic
970280038 4:14444901-14444923 CTCCACACAGACCCTCTACATGG - Intergenic
974557864 4:63475244-63475266 TTCCCCACAGATCTTTTGGATGG + Intergenic
978351097 4:107821743-107821765 TTCCACACAGAGGCTTATGAGGG + Intergenic
981591391 4:146366826-146366848 CTCCTTACAGATCCTTTTCTTGG + Intronic
988959668 5:36357353-36357375 ATCCACCCAGAGACTTTTGAAGG + Intergenic
990782304 5:59378879-59378901 CTCCACACACATCCATTTATAGG + Intronic
992414437 5:76539180-76539202 ACTCACACAGTTCCTTTTGAAGG - Intronic
992991279 5:82286301-82286323 CTCCAAGCAGATTCTTTTGGGGG - Intronic
996990848 5:129629011-129629033 CTCCACATAGAGCCAATTGAAGG - Intronic
1001587652 5:172844437-172844459 CACCAAACAAATCCTTCTGAGGG + Intronic
1002085914 5:176775228-176775250 CACCACACAGAGCTTTTTGAGGG + Intergenic
1004584645 6:16987794-16987816 CTCCCCACAGAGCCTCTAGACGG - Intergenic
1006671585 6:35732625-35732647 CTCCAGACAGATACTGTTGGGGG - Intergenic
1007850135 6:44794683-44794705 GACCACACAGATACTTTTCATGG + Intergenic
1008715439 6:54283773-54283795 CTCCACACAGATCCTACATAAGG + Intergenic
1011218278 6:85028750-85028772 CTCCAGAGACATCTTTTTGAAGG - Intergenic
1011782079 6:90800730-90800752 CTCCACAATGATCCCTTTCAGGG - Intergenic
1013070885 6:106728337-106728359 CTCCACATTCAGCCTTTTGAGGG + Intergenic
1016130182 6:140458382-140458404 CTTCAAACAGATGCTTTTGCTGG + Intergenic
1016633654 6:146261226-146261248 CTCCAGACAGATCCTTCAGTTGG - Intronic
1016687090 6:146894301-146894323 CTTCTCACAGAGCATTTTGAAGG - Intergenic
1019382917 7:736137-736159 CAGCACACAGATCATTTTCAAGG - Intronic
1030090706 7:105855418-105855440 CTCCATACAGATACATTAGATGG - Intronic
1030643032 7:112027161-112027183 CTACACACAGTTCCTTTTTCTGG - Intronic
1030875921 7:114813175-114813197 CTAAACACAAATCCTTGTGAGGG - Intergenic
1032785478 7:135196552-135196574 CTCCACACAGGCCCTGCTGAAGG + Intronic
1034667552 7:152831681-152831703 CTGCACACAGATCCTGCTGCTGG - Intronic
1036190996 8:6670711-6670733 CTCCACCCACACCCTTTAGAGGG + Intergenic
1039277731 8:35952089-35952111 CTCCACAGGGATGCTTTTCAGGG - Intergenic
1039791507 8:40879509-40879531 TTCCACACAAAGCCTTCTGATGG + Intronic
1041272508 8:56122960-56122982 CTCAACACTGATCCTTTTGGTGG - Intergenic
1043370514 8:79585268-79585290 CTCAACACAGAAGCTTTTCAGGG - Intergenic
1045509864 8:102806200-102806222 CCCCACCCAGTTCCCTTTGATGG - Intergenic
1047258932 8:123238830-123238852 CCCCAAAGAGATCCTTTTGTTGG + Intronic
1048868965 8:138781660-138781682 CTCCACACACATCCTGGAGAAGG + Intronic
1052244233 9:26314246-26314268 CTCAACACAGAACCCTTTGTGGG + Intergenic
1053466669 9:38313489-38313511 ACCCACACAGCTCCTTTTGTGGG - Intergenic
1054810016 9:69427112-69427134 CTTCTCACAGAACCTTTGGATGG + Intergenic
1055639735 9:78310355-78310377 ATCCACACTCATCCTTTTGCTGG - Intronic
1056144543 9:83716823-83716845 CATCACAAAGATCCTTATGAAGG - Intergenic
1056554803 9:87679403-87679425 CTCCAAACAGGTCCTTGTTAGGG + Intronic
1056726461 9:89123397-89123419 CTCCTCAATGATCCTCTTGAGGG + Intronic
1057073258 9:92118703-92118725 CTCCCCCCAGAGCCTTTGGAGGG - Intergenic
1057944160 9:99310025-99310047 CTCCATAACGATCCTTTTGTAGG - Intergenic
1062269267 9:135701233-135701255 CTGAACACAGATGCTTTTGAGGG - Intergenic
1062581147 9:137229815-137229837 CACCACACAGACCCTTTTGAGGG + Intergenic
1193308003 X:79972411-79972433 CTTCTCACAGCTCCATTTGATGG - Intergenic
1193408295 X:81131420-81131442 CCCCACACAGGTCCTTTGCAGGG - Intronic
1195380076 X:104261966-104261988 CTCTGCACAGATCCTGTAGAGGG + Intergenic
1198654850 X:138902258-138902280 CTCAACACAGGTTATTTTGATGG + Intronic
1198707554 X:139465095-139465117 CTCCACAAAGATGCTTTCCAAGG + Intergenic
1201757748 Y:17505252-17505274 CTCCACATAGATATTTTTGTAGG + Intergenic
1201843806 Y:18400730-18400752 CTCCACATAGATATTTTTGTAGG - Intergenic