ID: 918043368

View in Genome Browser
Species Human (GRCh38)
Location 1:180926671-180926693
Sequence CCGGAAGGCTCCGAGTGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918043358_918043368 27 Left 918043358 1:180926621-180926643 CCAGGTCTTGTGACAAATGCCCT 0: 1
1: 0
2: 1
3: 13
4: 166
Right 918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 87
918043361_918043368 7 Left 918043361 1:180926641-180926663 CCTCTGACAGCCGTGGAACCACA 0: 1
1: 0
2: 0
3: 9
4: 100
Right 918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 87
918043357_918043368 30 Left 918043357 1:180926618-180926640 CCACCAGGTCTTGTGACAAATGC 0: 1
1: 0
2: 0
3: 17
4: 156
Right 918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 87
918043360_918043368 8 Left 918043360 1:180926640-180926662 CCCTCTGACAGCCGTGGAACCAC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 87
918043362_918043368 -3 Left 918043362 1:180926651-180926673 CCGTGGAACCACAGCTGTCACCG 0: 1
1: 0
2: 1
3: 9
4: 149
Right 918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918043368 Original CRISPR CCGGAAGGCTCCGAGTGTGC GGG Intronic
900351549 1:2237358-2237380 CCTGAAGGCTGCGGCTGTGCCGG + Intronic
900936730 1:5770815-5770837 CATGAAGGCTCGGGGTGTGCAGG - Intergenic
907477216 1:54713791-54713813 TTGGAAGGTTCAGAGTGTGCTGG + Intronic
916739303 1:167634270-167634292 CCGGAAGGCTCCTTGAGGGCAGG + Intronic
918043368 1:180926671-180926693 CCGGAAGGCTCCGAGTGTGCGGG + Intronic
924908631 1:248484244-248484266 TCGTAAGGCTCTGAGAGTGCAGG - Intergenic
924915481 1:248563818-248563840 TCGTAAGGCTCTGAGAGTGCAGG + Intergenic
1069947736 10:71999364-71999386 CGGGAAAGCTCCATGTGTGCTGG - Intronic
1070809243 10:79289327-79289349 CTGGAAGGGTCCGAGTCTGAGGG - Intronic
1077096254 11:800338-800360 CCGGGAGGCTCAGGCTGTGCGGG - Exonic
1079133822 11:17764807-17764829 CGGGAATGCTCACAGTGTGCTGG - Intronic
1082811869 11:57483176-57483198 GCGGCTGGCTCCGAGGGTGCGGG - Intergenic
1084688559 11:70711547-70711569 CAGGAATGCTAGGAGTGTGCGGG + Intronic
1091630219 12:2154390-2154412 CAGGAAGATTCCGTGTGTGCGGG - Intronic
1097885028 12:64720429-64720451 CCTGAAGGCACAGGGTGTGCAGG - Intronic
1101951159 12:109176218-109176240 CCGGAAGGCTGAGAGTGCGGAGG + Exonic
1103915990 12:124376023-124376045 CCGGTAGGCTCGGGGTCTGCCGG - Intronic
1122724730 14:103742725-103742747 CTGGAAGGATCCGAGCGTGGAGG - Exonic
1122779196 14:104136506-104136528 CCGCAAGGCTCCCAGCCTGCTGG + Intergenic
1122943511 14:104994262-104994284 CTGGAGGGCTGTGAGTGTGCAGG + Intronic
1129266336 15:74395493-74395515 CATGAAGGCTCAGAGTGTTCTGG - Intergenic
1131843490 15:96463961-96463983 CTGGAAGGCTCTTAGTGTCCTGG + Intergenic
1132460924 16:54120-54142 CCGGCAGCCTCCGAAGGTGCTGG + Intronic
1145059044 17:19720848-19720870 CCAGCAGGCTCCGAGCCTGCAGG - Intergenic
1147601783 17:41751125-41751147 CAGGAAAGCTCTGAGTGTCCGGG - Intergenic
1148471528 17:47896516-47896538 CCGGCGGGCTCCGAGGGGGCGGG - Intronic
1152468097 17:80476836-80476858 CCCGAAGGCTCCGAGAGCTCAGG + Intronic
1160720430 19:594750-594772 CAGGAAGGCCCAGCGTGTGCAGG + Intronic
1160741025 19:685893-685915 CCGGAGGGCCCCTGGTGTGCAGG - Exonic
1160754715 19:751320-751342 CAGGGAGGCTCCGAGGGTGACGG - Intronic
1160974909 19:1788352-1788374 CTTGAAAGCTCTGAGTGTGCCGG + Intronic
1161430424 19:4229298-4229320 TCGGAAGGCCCCGAGGGTGGGGG - Intergenic
1162327165 19:10006196-10006218 CCTGAAGGCCCTGGGTGTGCAGG - Exonic
1162938392 19:13993578-13993600 CCGGTTGGCTGCGAGGGTGCGGG + Exonic
1165453386 19:35897820-35897842 CCCACAGTCTCCGAGTGTGCTGG + Exonic
1166043639 19:40217387-40217409 CCAGCAGGCTCTGAGAGTGCCGG - Intronic
1167014241 19:46829940-46829962 CCTGAAGGCACTGAGTGTCCAGG + Intergenic
1167315087 19:48758104-48758126 CCGGGTGGCTCCGGGAGTGCGGG - Exonic
932436078 2:71703238-71703260 CTGTGAGGCTCAGAGTGTGCAGG + Intergenic
934688926 2:96342529-96342551 CCTGAATGCTCAGTGTGTGCAGG - Intronic
937169750 2:119854182-119854204 CCAGATGACTCCGCGTGTGCAGG - Intronic
937994129 2:127680168-127680190 CGGGAGGGCTCCGGCTGTGCAGG - Intronic
938894411 2:135736156-135736178 CTGGAGGGCTCAGAGTGGGCAGG - Intergenic
942218871 2:173749887-173749909 CCTGAAGGCTGAGTGTGTGCCGG + Intergenic
948825447 2:240571591-240571613 CAGGAGGGCCCCGGGTGTGCAGG + Intronic
1169908749 20:10629944-10629966 CCAGAAGGCTGAGTGTGTGCGGG + Intronic
1173170232 20:40717586-40717608 ACGGCAGCCTCCGAGGGTGCTGG - Intergenic
1174506942 20:51023090-51023112 CCGCCGGGCTCCGAGTGCGCCGG + Exonic
1178978229 21:37239042-37239064 CAGGAAGGCTCCGAGGAAGCTGG - Intronic
1179646099 21:42777273-42777295 CGGGCAGGCTCTGGGTGTGCAGG - Intergenic
1180951391 22:19722175-19722197 CCGGGAGGCTCAGCGTGGGCTGG - Intronic
1181864005 22:25841020-25841042 CCGGAATGCCCCAAGTGTTCTGG - Intronic
1184666375 22:45991290-45991312 ACGGAAAGCTCAGAGAGTGCTGG + Intergenic
953369498 3:42375419-42375441 CAGGATGGCTCCCAGTGTACTGG - Intergenic
954265834 3:49469941-49469963 TCTGAAGGCTCCGAGTGACCGGG + Intronic
954766441 3:52921675-52921697 CAGGAAGGCTTCTAGAGTGCTGG + Intronic
962726609 3:138234357-138234379 CCGGCAGCCTCCCAGAGTGCTGG + Intronic
966735081 3:183181378-183181400 CTGGCAGGCTCCGAGGGGGCTGG + Intronic
968916525 4:3499258-3499280 TCTGAGGGCTCGGAGTGTGCTGG + Intronic
969567027 4:7984721-7984743 GCAGAAGGCTCCGGGAGTGCCGG - Intronic
982692808 4:158567199-158567221 CGGGGAGGCTCCGGCTGTGCAGG - Intronic
985705712 5:1400405-1400427 CTGGATGGCTCCCAGGGTGCAGG + Intronic
985780810 5:1869828-1869850 CCTGCAGGCTCAGAGTGGGCTGG - Intergenic
990512105 5:56498721-56498743 CCGGAAGGCTCCGGGGGCGCAGG + Intergenic
997295569 5:132766366-132766388 GCGGCAGGCCCCGAGTGAGCTGG + Intronic
997488266 5:134250242-134250264 TCCAAAGGCTCTGAGTGTGCAGG - Intergenic
1002790704 6:435639-435661 CCGGGAGGCTCGGGCTGTGCAGG + Intergenic
1003399755 6:5782050-5782072 CCGGATGCCCCCGAGTGTTCTGG + Intergenic
1007785920 6:44279267-44279289 CTGGAAGGCTCCATGTGTCCTGG + Exonic
1013126637 6:107190852-107190874 CCAGCAAGCTCCGAATGTGCCGG + Intronic
1018358760 6:163044683-163044705 CCCGCGGGCTACGAGTGTGCTGG + Intronic
1019756487 7:2774485-2774507 CTGGGAGGCCCTGAGTGTGCAGG + Intronic
1024366735 7:48528895-48528917 CAGGCAGCCTCTGAGTGTGCAGG - Intronic
1029270751 7:99375261-99375283 CCGGAAGGCTCCGGGGATGGAGG - Intronic
1029376190 7:100178107-100178129 CGGGAAGGCTCCTAGTGTCAGGG - Intronic
1030109162 7:106011796-106011818 TCGGAAGGCTCTGAGTTTGGGGG + Intronic
1033589242 7:142796631-142796653 CCGGAGAGCTCCGAGAGGGCGGG + Intergenic
1049317561 8:141977402-141977424 AAGGCAGGCTCCGAGTGTGCGGG - Intergenic
1049672120 8:143874600-143874622 CCGGAAGGCGAGGAGTGGGCAGG - Intronic
1049690796 8:143958012-143958034 CCGGAGGGCTGAGTGTGTGCTGG - Intronic
1051174232 9:14347302-14347324 CCCGAAGGCACTGACTGTGCAGG - Intronic
1052326048 9:27217686-27217708 AGGGAAGGCTCCCAGTGCGCTGG + Exonic
1055954059 9:81757561-81757583 GGGGAAGGCTCTGACTGTGCTGG + Intergenic
1061719440 9:132542701-132542723 CTGGAATGCTCCGGGTGTCCTGG + Intronic
1062270272 9:135705049-135705071 CCGGCAGCCTCCAAGTGTGCTGG + Intronic
1062318637 9:135979890-135979912 CTGGGAGGCTCCGGCTGTGCTGG - Intergenic
1188654471 X:32674125-32674147 CAGGAAGGCTCTGAAAGTGCAGG + Intronic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1196733639 X:118965464-118965486 CTGGAAGGCACTGAGTGTTCTGG - Intergenic
1197806310 X:130401874-130401896 GCGGAAGGCTGCTAGTGCGCAGG + Intergenic
1200067878 X:153513179-153513201 CCGGAAGGCTCCAGGCGTCCTGG + Intergenic