ID: 918043618

View in Genome Browser
Species Human (GRCh38)
Location 1:180928040-180928062
Sequence AGGGCCCGGGGTTGTTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918043618_918043632 18 Left 918043618 1:180928040-180928062 CCAGCCCAACAACCCCGGGCCCT 0: 1
1: 0
2: 3
3: 17
4: 228
Right 918043632 1:180928081-180928103 GATAGCTCCTGCTGTCTGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 269
918043618_918043634 20 Left 918043618 1:180928040-180928062 CCAGCCCAACAACCCCGGGCCCT 0: 1
1: 0
2: 3
3: 17
4: 228
Right 918043634 1:180928083-180928105 TAGCTCCTGCTGTCTGCCTGGGG 0: 1
1: 0
2: 5
3: 32
4: 315
918043618_918043633 19 Left 918043618 1:180928040-180928062 CCAGCCCAACAACCCCGGGCCCT 0: 1
1: 0
2: 3
3: 17
4: 228
Right 918043633 1:180928082-180928104 ATAGCTCCTGCTGTCTGCCTGGG 0: 1
1: 0
2: 2
3: 28
4: 217
918043618_918043635 24 Left 918043618 1:180928040-180928062 CCAGCCCAACAACCCCGGGCCCT 0: 1
1: 0
2: 3
3: 17
4: 228
Right 918043635 1:180928087-180928109 TCCTGCTGTCTGCCTGGGGAAGG 0: 1
1: 1
2: 4
3: 56
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918043618 Original CRISPR AGGGCCCGGGGTTGTTGGGC TGG (reversed) Intronic
900314771 1:2051175-2051197 AGGGCTCGGGGCGGTCGGGCGGG + Intronic
900534330 1:3169564-3169586 AGGTCCCGGGGTTGTTGCTGAGG + Intronic
901492005 1:9601469-9601491 AGGGCCAGGAGTTGGCGGGCAGG + Intronic
901955160 1:12778744-12778766 AGGGGCTGGTGCTGTTGGGCAGG + Intergenic
901978097 1:13011407-13011429 AGGGCCTGGTGTTGTTGGGCAGG - Intronic
902003989 1:13217531-13217553 AGGGCCTGGTGTTGTTGGGCAGG + Intergenic
902023212 1:13363275-13363297 AGGGCCTGGTGTTGTTGGGCAGG + Intergenic
902254278 1:15177438-15177460 AGGGGCCGGGGAGGATGGGCAGG + Intronic
903215537 1:21841602-21841624 AGGTACCGTGGTTGCTGGGCCGG + Exonic
903772929 1:25775399-25775421 AGGGCCCAGGGCTGGTGGGCTGG - Intronic
904622211 1:31782315-31782337 TGGGCCTGGGCTGGTTGGGCTGG + Intergenic
904770948 1:32881153-32881175 CGGGGCAGGGGTTGCTGGGCTGG + Intergenic
905646228 1:39626636-39626658 AGGACCAGGGGGTGTTGGGGAGG + Exonic
905803790 1:40861943-40861965 AGGGCCCCGGGTTGGCGGGGCGG + Exonic
913661329 1:121008678-121008700 AGGGCGCGTGGTTGCGGGGCGGG - Intergenic
914012696 1:143791858-143791880 AGGGCGCGTGGTTGCGGGGCGGG - Intergenic
914165134 1:145169326-145169348 AGGGCGCGTGGTTGCGGGGCGGG + Intergenic
914651321 1:149700467-149700489 AGGGCGCGTGGTTGCGGGGCGGG - Intergenic
917044832 1:170847954-170847976 AGAGGCTGGGGTGGTTGGGCAGG - Intergenic
918043618 1:180928040-180928062 AGGGCCCGGGGTTGTTGGGCTGG - Intronic
920187891 1:204173122-204173144 AGAGCCCTGGGTTGGTGGTCAGG + Intergenic
921899692 1:220437080-220437102 ATGGCCCAGGGGTGGTGGGCTGG - Intergenic
1063008588 10:1999500-1999522 AGGGGGCGGGGTTGGGGGGCAGG - Intergenic
1064228632 10:13509400-13509422 AAGGCCAGGGGTGGGTGGGCTGG + Intronic
1067217748 10:44316733-44316755 AGGGCCCAGGGCTGGTGGGAGGG - Intergenic
1070802098 10:79249839-79249861 AGAGCCCCGGGTAGTTGGGCAGG - Intronic
1073064943 10:100752749-100752771 AGGGGCAGGGGGTGTTGGACGGG - Intronic
1073317637 10:102593936-102593958 AGGGTCTGGGGCTGATGGGCTGG - Intronic
1076691913 10:132228133-132228155 AGGGCACAGGGCTGTTCGGCAGG + Intronic
1077100727 11:821210-821232 CAGGCCCGGGAGTGTTGGGCTGG - Intronic
1077236774 11:1485691-1485713 AGGGGCCGGGGGAGTGGGGCAGG - Intronic
1077487842 11:2847222-2847244 AGGGCCTGGGGTGGTTGAGGAGG - Intronic
1077494654 11:2881005-2881027 AGGGCAGAGGGATGTTGGGCTGG - Intergenic
1081668093 11:44928177-44928199 AGGGCCTGGGGTGGTGGGGCAGG - Intronic
1081710491 11:45212682-45212704 AAGGCCCGTGGTGGGTGGGCTGG - Intronic
1083141942 11:60729384-60729406 AGGCCACAGGGTTGCTGGGCTGG - Exonic
1084393043 11:68891065-68891087 AGGGCCCAGGGGAGTGGGGCGGG - Intergenic
1084486105 11:69449278-69449300 AGGGTTGGGGGTAGTTGGGCCGG - Intergenic
1084743005 11:71151153-71151175 AGGGCCCAGGGCTGATGGGGCGG - Intronic
1087324651 11:96706761-96706783 ATGGCCCAGGGGTGGTGGGCTGG + Intergenic
1089029034 11:115303722-115303744 AGGGCACAGGGTTGTGGGGAGGG - Intronic
1096073863 12:48789813-48789835 AGGGCGGGGGGTTGTGGGGGCGG - Intergenic
1097281238 12:57846448-57846470 CGGGCCCGGGCTGGCTGGGCGGG + Exonic
1101292213 12:103382474-103382496 AAGGCCAGGGGTTTTGGGGCAGG - Intronic
1101903165 12:108806677-108806699 GGGGCCTGGGGATGTTGCGCTGG - Intronic
1103724240 12:122989860-122989882 GGGGCCAGGGGTGGTGGGGCTGG + Exonic
1104712280 12:130995273-130995295 GGGGGCTGGGGTTGTTGGGTGGG + Intronic
1104733542 12:131122190-131122212 GGGGCCCAGGGGTGTTGCGCGGG + Intronic
1105407528 13:20144466-20144488 AGTGCCCATGGGTGTTGGGCAGG + Intronic
1115194249 14:30778631-30778653 AGAGCCCGGGGTCCTAGGGCAGG + Intergenic
1118992513 14:70809290-70809312 AGGGCCCGGGCTGGCAGGGCTGG + Exonic
1122060609 14:99134420-99134442 AGGGCCTGGGGTTGCAAGGCTGG + Intergenic
1122385421 14:101342042-101342064 AGGGCTGGGGGATGGTGGGCAGG - Intergenic
1122448317 14:101783442-101783464 AGGTCACGGTGTTGTGGGGCAGG + Intronic
1122920318 14:104877284-104877306 GGTCCCCGGGGTTGTTGGCCTGG + Intronic
1122981520 14:105194310-105194332 AGGCCCCAGGGTGGTTGGCCGGG - Intergenic
1202865346 14_GL000225v1_random:113868-113890 GCGGCCGGGGGTTGTTGGGGTGG + Intergenic
1123415674 15:20093305-20093327 TGGGCCTGTGGGTGTTGGGCAGG - Intergenic
1123525013 15:21100419-21100441 TGGGCCTGTGGGTGTTGGGCAGG - Intergenic
1124422607 15:29535986-29536008 AGGGAACGTGGCTGTTGGGCAGG - Intronic
1128455393 15:67828731-67828753 AGGGCCGGGGCTTGAGGGGCAGG + Intronic
1128519185 15:68364488-68364510 AGGGCCCTGGGTGTTTTGGCAGG - Intronic
1129946364 15:79542448-79542470 AGGGCCCAGAGTTGTAGGGGTGG - Intergenic
1130010993 15:80152857-80152879 AGGGCTCGGGGTTCGGGGGCGGG + Exonic
1130151301 15:81313650-81313672 AGGGTACTGGGTTTTTGGGCTGG - Intronic
1131270859 15:90946924-90946946 TGGGCCTGGGGTGGGTGGGCAGG + Intronic
1132779401 16:1614430-1614452 AGGGTCCCGGGCTGGTGGGCAGG + Intronic
1132845766 16:2000157-2000179 AGGGCCCGGGGTTGCTGCAGTGG + Exonic
1136499392 16:30662547-30662569 GGGGCCCGAGGCTGTGGGGCAGG - Exonic
1137273881 16:46920595-46920617 AGGGCTCTTGGTTGTTAGGCTGG + Intronic
1137285829 16:47014776-47014798 AGGGTCTGGGATTGTTGGGCAGG + Intergenic
1138529759 16:57628599-57628621 AGGGACCGGGTTTGTTTGGTGGG - Intronic
1139719430 16:68840803-68840825 AAGGCCTGGGATGGTTGGGCAGG - Intergenic
1141079260 16:81036152-81036174 TGAGCGCGGGGCTGTTGGGCAGG - Exonic
1141158551 16:81613400-81613422 AGTGCCCAGGGAAGTTGGGCAGG - Intronic
1141698405 16:85631437-85631459 AGGGCACGGGGCTTGTGGGCAGG + Intronic
1141812197 16:86383162-86383184 TGGGCCGGGGGATCTTGGGCAGG - Intergenic
1142150731 16:88511495-88511517 AGGGCCGGGGGATGCTGAGCTGG - Intronic
1142670179 17:1484460-1484482 AGGGCCTGGGTGTGGTGGGCCGG + Intronic
1143119659 17:4598953-4598975 AGGGGCCGGGGTGGTGGGCCAGG - Intronic
1143175890 17:4954994-4955016 AGGGGCGGGGGGTGTTGGGGTGG - Intronic
1143465856 17:7135790-7135812 AGGGGGAGGGGTTGGTGGGCGGG + Intergenic
1144595791 17:16569150-16569172 AGGCGCCGGGGTTTCTGGGCCGG - Exonic
1144753539 17:17666341-17666363 GGGGCCCGGGGATCCTGGGCAGG - Intergenic
1146311954 17:31776244-31776266 AGGGCAGGGGATGGTTGGGCAGG + Intergenic
1147953823 17:44121639-44121661 GGGGCCTGGGAATGTTGGGCGGG - Intronic
1147976900 17:44253061-44253083 AGGGGCCGGGGGTGAGGGGCAGG + Intronic
1148196272 17:45715666-45715688 AGTGCCCAGGATTGATGGGCTGG - Intergenic
1148212986 17:45819445-45819467 GGGGCCCGGGGGTGGTGGGATGG - Intronic
1148431881 17:47649735-47649757 AAGGCCCGGGTTGGCTGGGCGGG - Intronic
1148741850 17:49897554-49897576 CGGGCTCGGGGCTGTTGGGTAGG - Intergenic
1148770021 17:50061171-50061193 AGGGGCCTGGGATGTAGGGCTGG + Intronic
1148793183 17:50184970-50184992 AGGGCCTGGGGGTGCTGGGCGGG + Exonic
1149660446 17:58331818-58331840 AGGACCCTGGGCTGTTGGGGAGG - Intergenic
1150281782 17:63933114-63933136 AGGTCCAGGGGGTCTTGGGCAGG + Intergenic
1150978204 17:70112162-70112184 AGGGCTAGGGGTTGATGGGCAGG + Intronic
1151575844 17:74952229-74952251 AGGGCCGGGGGTTGTGGGCGGGG - Intronic
1152281364 17:79386634-79386656 GGTGCCCGTGGTTGTTGGCCGGG - Intronic
1152409930 17:80118111-80118133 AGGGCCCGGGAATGCTAGGCTGG - Intergenic
1157190429 18:45576859-45576881 AGGCACCAGGGTTGTGGGGCTGG + Intronic
1160231489 18:77052786-77052808 CAGGCCCGGTGTTGCTGGGCTGG - Intronic
1160835495 19:1122814-1122836 AGGGCCTGGGGGTGCTGGCCCGG + Intronic
1161378081 19:3950355-3950377 AGGGCCCTGGGGTGGGGGGCGGG - Intergenic
1161392551 19:4028873-4028895 CGGGGCCGGGGTTGGGGGGCAGG - Intronic
1161977935 19:7616403-7616425 AGGGCCGAGGGGTCTTGGGCAGG + Intronic
1162798044 19:13096589-13096611 AGGCCCCGGGGGTGGGGGGCCGG + Intronic
1163622430 19:18369004-18369026 AGGGCCCGGGGCTGCTGGTTGGG + Exonic
1163779898 19:19240576-19240598 AGGGTCGGGGGTTGTGGGTCTGG - Intronic
1163848486 19:19650620-19650642 AGGGCCTGGGGATTGTGGGCAGG - Intronic
1165149308 19:33751609-33751631 AGTGCCCGGGGACGGTGGGCCGG - Intronic
1165422442 19:35728917-35728939 AGGGCCCTGTGTTGGTGGCCTGG + Intronic
1165426751 19:35750140-35750162 AGGCCATGGGGTTGGTGGGCTGG + Intronic
1165433907 19:35786746-35786768 AGGGGCGGGGGGTGCTGGGCTGG - Intronic
1165749654 19:38252185-38252207 GGGGCCGGGGGTGGTGGGGCCGG + Intronic
1166892354 19:46001094-46001116 AGGGGGTGGGGTTGATGGGCGGG + Intronic
1167323977 19:48812881-48812903 AAGGCCTGGGGTTGGGGGGCGGG + Intergenic
1167424554 19:49423380-49423402 GGGGCCCGGGGTTCTGGGCCGGG - Exonic
1167799668 19:51732014-51732036 AGGGCCCAGGGCTGGTGGCCTGG + Intergenic
1168026624 19:53648087-53648109 CGGGCCCGGGGTGGATGGGCCGG - Intergenic
1168421218 19:56205065-56205087 AGGGGCTGGGGTGGGTGGGCAGG + Intronic
1168424229 19:56225851-56225873 AGGGGCTGGGGTGGGTGGGCAGG - Intronic
1168692716 19:58386550-58386572 AGGGCCCGGGGTTGCGGCGGCGG - Intronic
925669335 2:6294316-6294338 AGGGCCTGGGGGTGATTGGCTGG + Intergenic
927810189 2:26176154-26176176 GGGGCCTGGGGCTGTGGGGCTGG - Intronic
932495991 2:72146043-72146065 AGGGCCCCGGGTTGGAGGGATGG + Intronic
933764593 2:85698138-85698160 AGGGCCCAGGATTGTGGGGGAGG - Intronic
933994131 2:87655442-87655464 AGGGCCCAGGACTGATGGGCGGG + Intergenic
933997287 2:87679282-87679304 GAGGCCCAGGGTTGTTGGGGAGG - Intergenic
934712305 2:96523952-96523974 AGGGCCAGGGGATGAAGGGCAGG - Intergenic
936296565 2:111271628-111271650 GAGGCCCAGGGTTGTTGGGGAGG + Intergenic
936299734 2:111295471-111295493 AGGGCCCAGGACTGATGGGCGGG - Intergenic
937201575 2:120207420-120207442 AGGGCCCGGGGGCCTGGGGCGGG + Intergenic
937322682 2:120970411-120970433 AGGCCACGGGGTTGATGGGGTGG - Exonic
937342538 2:121100448-121100470 AGAGCCCGGTGTTGTTGGAAAGG - Intergenic
938742244 2:134243859-134243881 AGGGGTCGGGGTAATTGGGCTGG + Intronic
944844104 2:203651897-203651919 AGGACCGGGGGTTGTGGGGAGGG - Intergenic
947794780 2:232887424-232887446 AAGGCCCAGGGCTCTTGGGCAGG + Intronic
948425144 2:237882704-237882726 AGGGCCTGGGGTTCTAGGGTGGG + Intronic
1172883754 20:38217944-38217966 AGAGCCGGGGGTTGGAGGGCAGG - Intronic
1173685935 20:44923705-44923727 AGTGCCCGAGGTTCCTGGGCTGG + Intronic
1175004151 20:55664518-55664540 AGGGTCAGGGGTTCTTGTGCAGG - Intergenic
1175302507 20:57952891-57952913 AAGGCCCGGGGCTGTGGGCCTGG - Intergenic
1179196568 21:39169625-39169647 AGGGCCTGGGGTAATTGGGGAGG - Intergenic
1179543682 21:42100711-42100733 AGGGCACGGGGTTGCTGGGGTGG - Intronic
1179543696 21:42100745-42100767 AGGGCATGGGGTTGCTGGGGTGG - Intronic
1179543710 21:42100779-42100801 AGGGCACAGGGTTGGTGGGGTGG - Intronic
1179543724 21:42100813-42100835 AGGGCACGGGGTTGCTGGGGTGG - Intronic
1179543738 21:42100847-42100869 AGGGCACGGGGTTGGTGGGGTGG - Intronic
1179543753 21:42100881-42100903 AGGGCACGGGGTTGGTGGGGTGG - Intronic
1179543767 21:42100914-42100936 AGGGCATGGGGTTGGTGGGTGGG - Intronic
1179543780 21:42100944-42100966 AAGGCACGGGGTTGGTGGGTAGG - Intronic
1179601876 21:42484554-42484576 TGGGCCCAGGGTGGTGGGGCAGG + Intronic
1180067993 21:45422339-45422361 AGGCCCTGGGCTTGGTGGGCAGG + Intronic
1180236021 21:46459522-46459544 AGGTCCCGGGGGTGAGGGGCGGG - Intronic
1181422705 22:22812694-22812716 AGAGCCCGAGGTTGTGGGGGAGG + Intronic
1181475013 22:23162655-23162677 GGGGCCTGGGGCTGTGGGGCTGG - Exonic
1182022604 22:27093907-27093929 AGGGCCTGGGGGTGTGGGGAAGG - Intergenic
1182544412 22:31066174-31066196 TGGGCCTGTGGGTGTTGGGCAGG + Intronic
1182736407 22:32534426-32534448 AGGGCCCGGGGCGGGTGGGCTGG + Intronic
1183734364 22:39635704-39635726 AGGGCCTGGGGCAGTGGGGCTGG + Intronic
1183780124 22:39994517-39994539 AGGGTCCGGTGTTGGTGGGGGGG - Intergenic
1184070065 22:42141899-42141921 AGGTCTCGGGGTGGCTGGGCTGG + Intergenic
1184291143 22:43498745-43498767 AGGCCCTGGGGATGTTGGGCTGG - Intronic
953018341 3:39098684-39098706 AGGACCCCGGGTTGTTGGGAAGG - Intronic
954409407 3:50363932-50363954 AGGGCGAGGGGTTGGTGGGAGGG - Intronic
954627544 3:52030769-52030791 AGGGGCTGGGGTGGTGGGGCTGG - Intergenic
954794569 3:53155006-53155028 AGGGCCCGTGGGTACTGGGCAGG - Intergenic
954812459 3:53256409-53256431 TGGGCCTGGGGTTGGTCGGCTGG - Intergenic
960289099 3:115862091-115862113 GGGGCAGGGGGTTGTTTGGCAGG + Intronic
961394577 3:126578214-126578236 AGGACCCGGGGCTGTGGAGCAGG + Intronic
961456515 3:127027294-127027316 AGGGCCCGGGGCTGTGCTGCTGG + Intronic
964606207 3:158562823-158562845 AAGGCCAGAGGTTGTCGGGCGGG - Intergenic
966744504 3:183262933-183262955 GGGGTCTGGGGTTGTTGGGGTGG + Intronic
966924562 3:184635947-184635969 AGGGCCTGGGGTTGGGTGGCGGG + Intronic
968235677 3:197029129-197029151 AGGGCCCGGGATGGTGGGACGGG - Intronic
968518379 4:1024207-1024229 AGGGCTTGGGGGTGGTGGGCTGG + Intronic
969401169 4:6956617-6956639 AGGGACCGGGGTTGCTTGCCCGG + Intronic
970784053 4:19774851-19774873 AGGGGCCAGGGTTGGAGGGCAGG + Intergenic
970794214 4:19892336-19892358 TGGCCCCGGGGTTGGTGGGTAGG - Intergenic
971422932 4:26490515-26490537 AGGGCCGGGGGAGGTGGGGCGGG - Intergenic
971518891 4:27524338-27524360 AGGGCCTGGTGTTGAGGGGCAGG + Intergenic
974409244 4:61517541-61517563 AGGGCTGGGGGTGGCTGGGCAGG + Intronic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
985521591 5:376273-376295 GGGGCCCTGGGGGGTTGGGCAGG + Intronic
987089292 5:14497125-14497147 AGGGCACGGGGCTGGTGGGTGGG - Intronic
994201262 5:96978818-96978840 AGGGTCCCAGGTTGTGGGGCAGG + Intronic
994595648 5:101830974-101830996 AGGAGCTGGGGTTGTTGGGGTGG - Intergenic
995865600 5:116686743-116686765 AGTGCCCGGGGTGGTTGGGGAGG + Intergenic
997337752 5:133119983-133120005 TGGGCCAGGGCATGTTGGGCTGG - Intergenic
998372962 5:141672832-141672854 AGGGGTCGGGGTGGTTGGGGGGG + Exonic
999146905 5:149402310-149402332 AGGGCCCTGGGTGGTTGGCTTGG - Intronic
1002599436 5:180345970-180345992 TGGGGCCGGGGGTGTTGTGCGGG - Intronic
1002711131 5:181195564-181195586 AGCGGCAGGGGTGGTTGGGCAGG + Exonic
1004087216 6:12462153-12462175 AGGGCCCAGGGTTGGAGGGTGGG - Intergenic
1006257099 6:32840669-32840691 TGGGCCTGTGGTTGTTGGGTGGG - Intergenic
1006370539 6:33641283-33641305 AGGTCCTGGGCGTGTTGGGCAGG + Intronic
1007034680 6:38662380-38662402 AGAGCCCAGAGTTGTGGGGCTGG + Intergenic
1008094605 6:47326906-47326928 AGGGCCTTGGGTTGTCGGGGAGG + Intergenic
1019303819 7:322832-322854 GGGGCCCAGGGATGTTGAGCAGG + Intergenic
1020867876 7:13590111-13590133 AGAGACGGGGGTTGTTGGCCAGG + Intergenic
1023403910 7:39811793-39811815 AGGTAGCGGGGTTGTGGGGCAGG + Intergenic
1031793149 7:126135553-126135575 AGGGCCCTGGGTGGTGGGGGGGG - Intergenic
1032708986 7:134446432-134446454 TGGGCCTGGGGCTCTTGGGCAGG - Intronic
1035131343 7:156656870-156656892 AGGGCCTGGCGCTGGTGGGCTGG + Intronic
1035682050 8:1495380-1495402 AGGGCCCTGGGGTGTGTGGCCGG - Intergenic
1040931314 8:52738260-52738282 AGGGCCCTGGGATGTGGGACTGG - Intronic
1041409094 8:57533869-57533891 AGGGCTCGGGGTTCCTGGGGAGG + Intergenic
1041775702 8:61520692-61520714 AGGGCCTGGGGCTGCTTGGCAGG + Intronic
1042380605 8:68109035-68109057 AGGGCCTGGGGTGGTTGGGTGGG + Intronic
1042568793 8:70140273-70140295 AGGGCCAGGAGTTGTGGGGAGGG - Intronic
1049213663 8:141398074-141398096 AGGGCCCAGTGGTGTTGGGATGG + Intronic
1049362008 8:142216328-142216350 AGGGGCTGGGGGTGTGGGGCTGG + Intronic
1049606730 8:143533055-143533077 AGGGCCCCGGGGTGTCTGGCAGG - Intronic
1049804891 8:144534287-144534309 AGGGCCCTGGGGGGCTGGGCTGG + Intronic
1049844591 8:144793637-144793659 AGGGCCAGGGGCTGAGGGGCAGG + Intergenic
1051121081 9:13753117-13753139 ACGGCCCAGGGAGGTTGGGCTGG - Intergenic
1051822411 9:21182978-21183000 AGGTCCCGGGGAGGCTGGGCAGG + Intergenic
1051823646 9:21195033-21195055 AGGCCCCGGGGAGGCTGGGCAGG + Intergenic
1051825464 9:21213569-21213591 AGGCCCCGGGGAGGCTGGGCAGG + Intronic
1051827449 9:21235631-21235653 AGGTCCCGGGGAGGCTGGGCAGG + Intronic
1052971714 9:34380827-34380849 AGGGGGCGGGGTTCTGGGGCGGG + Intronic
1053122713 9:35558607-35558629 AGAGCCCGGGGGTGGGGGGCAGG - Intronic
1057334336 9:94144026-94144048 AAGGCCTGGGGTTGCTGTGCAGG + Intergenic
1057347104 9:94260422-94260444 AGGACCCGGGTTTGTGGGGGAGG + Intronic
1057463824 9:95292616-95292638 TGAGCGCGGGGCTGTTGGGCAGG - Intronic
1057736774 9:97669907-97669929 GGGGCGGGGGGTTGTTGGGGGGG - Intronic
1057868755 9:98702160-98702182 AGGGCCAGGGCTTATTGGACAGG + Intronic
1058351668 9:104032486-104032508 AGGGGCAGGGGTTGGTGGGCGGG - Intergenic
1061601225 9:131671487-131671509 AAGGCCCCACGTTGTTGGGCTGG - Intronic
1061911698 9:133728443-133728465 AGGGCCAGAGGCTGTGGGGCAGG - Intronic
1062027572 9:134347573-134347595 AGGGGCCTGCGTTGATGGGCAGG + Intronic
1062047810 9:134432479-134432501 AGGGCTTGGGGCTGTGGGGCTGG + Intronic
1062093692 9:134691807-134691829 AGGGACGGGGGATGTAGGGCAGG + Intronic
1062337002 9:136075742-136075764 AGGGCCTGTGGGTGTTGGGTGGG - Intronic
1062380020 9:136282631-136282653 TGGCCCAGGGGTTGTTAGGCAGG + Intronic
1062582752 9:137235719-137235741 AGTGCTCGGGGGTGCTGGGCTGG + Intronic
1203738996 Un_GL000216v2:162296-162318 GCGGCCGGGGGTTGTTGGGGTGG - Intergenic
1186998191 X:15146727-15146749 AGGGGCTGGGGTTGTGGGGACGG - Intergenic
1195196771 X:102504735-102504757 AGGGGCCCTGGTTGTGGGGCAGG + Intergenic
1195197754 X:102516417-102516439 AGGCCCCGGGGTTGGGAGGCGGG - Intronic
1196659316 X:118253183-118253205 CTGGTCTGGGGTTGTTGGGCTGG - Intergenic
1198107559 X:133475969-133475991 AGTGCCCTGGGTGGGTGGGCAGG + Intergenic
1198534935 X:137575731-137575753 AGGGCCCCAGGTGGGTGGGCAGG + Intronic
1199739052 X:150715280-150715302 AGAGGCCAGGGTTGTTGGGTGGG + Intronic
1199872929 X:151913971-151913993 AAGGGCCCGGGTTGTTGGGGTGG - Intronic
1199873456 X:151916015-151916037 AAGGGCCCGGGTTGTTGGGGTGG - Intronic
1199874162 X:151918734-151918756 AAGGGCCCGGGTTGTTGGGGTGG - Intronic
1200066910 X:153508346-153508368 AGGGCACGGGGTTGTTGAAGAGG - Exonic
1200116510 X:153771971-153771993 AGGGCTCAGGGTTGCAGGGCCGG - Exonic