ID: 918043730

View in Genome Browser
Species Human (GRCh38)
Location 1:180928501-180928523
Sequence CCGGGTCCTGGCCTTCATGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918043730_918043742 20 Left 918043730 1:180928501-180928523 CCCGCATGAAGGCCAGGACCCGG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 918043742 1:180928544-180928566 CATCGTGCCCACCATTACCCAGG 0: 1
1: 0
2: 1
3: 3
4: 79
918043730_918043743 21 Left 918043730 1:180928501-180928523 CCCGCATGAAGGCCAGGACCCGG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 918043743 1:180928545-180928567 ATCGTGCCCACCATTACCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 55
918043730_918043746 28 Left 918043730 1:180928501-180928523 CCCGCATGAAGGCCAGGACCCGG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 918043746 1:180928552-180928574 CCACCATTACCCAGGGCAGCCGG 0: 1
1: 0
2: 2
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918043730 Original CRISPR CCGGGTCCTGGCCTTCATGC GGG (reversed) Exonic
900152025 1:1182957-1182979 CCGGGTCTTGGCCTGCAGGGCGG - Exonic
900196901 1:1381124-1381146 CCTGGGCCTGGCCTTGCTGCAGG + Intergenic
900457806 1:2785897-2785919 CAGGGCCCTGGCCATCCTGCGGG - Exonic
900755445 1:4431287-4431309 CAGCGTCCTGGCCATCTTGCAGG - Intergenic
902368107 1:15990393-15990415 GCGGGTGCTGGGCTTCATGGTGG - Intergenic
902884755 1:19396559-19396581 CCCCGTGCTTGCCTTCATGCTGG - Intronic
905387471 1:37614429-37614451 CAGGGTCCTGCCCTCCATGTAGG - Intronic
905931636 1:41792173-41792195 CCAGGTCCTGGGCTACATGCTGG - Intronic
906704257 1:47883161-47883183 CCGTTTCCTGGCCTACAAGCTGG - Intronic
912438920 1:109683362-109683384 CTGGGGCCTGGCCTTCTTCCTGG + Intronic
912441442 1:109701807-109701829 CTGGGGCCTGGCCTTCTTCCTGG + Intronic
912764390 1:112395977-112395999 CTGGGTCCTGGGCTTCAGGGTGG - Intergenic
915451547 1:156008945-156008967 CTGGGTTCTGGCCTTGCTGCAGG - Intergenic
918043730 1:180928501-180928523 CCGGGTCCTGGCCTTCATGCGGG - Exonic
920261877 1:204693897-204693919 CAGGGTCATGGCCTGCATGGAGG - Intergenic
922011065 1:221588047-221588069 CAGGGTCCTGTGCTGCATGCAGG + Intergenic
924042401 1:239997433-239997455 GGGGGTTCAGGCCTTCATGCAGG - Intergenic
924300461 1:242632658-242632680 CAGAGTCCTTGCCTTCATGGAGG + Intergenic
924615635 1:245609468-245609490 CCGGGGACTGGCCGTCCTGCAGG - Exonic
924864507 1:247963035-247963057 GTGGGTTCTTGCCTTCATGCAGG + Intronic
1066065396 10:31757942-31757964 CCTGGCTCTGGCCTTCATGTAGG - Intergenic
1067791063 10:49288188-49288210 CCCACTCCTGGCCTTCATGGAGG - Intergenic
1069961284 10:72080864-72080886 CCGGGCCCTGACCTCCCTGCTGG + Intronic
1070793431 10:79203171-79203193 CTGGGTCCTGGCCCTCAAGGAGG - Intronic
1075792933 10:125098484-125098506 CCAGGTCCTGGCCTTCCTAAGGG - Intronic
1075853794 10:125610323-125610345 CTGGGTTCTTGGCTTCATGCAGG - Intronic
1076209551 10:128629455-128629477 CCATGTCCTGGTCTTCATCCAGG + Intergenic
1076440922 10:130480942-130480964 CAGGGGCCTGGCCTCGATGCTGG - Intergenic
1076855924 10:133115621-133115643 CGGGGTCCTGGCCTCCCTCCTGG - Intronic
1077109689 11:856638-856660 CCGGGTCCAGGCCCAGATGCTGG + Intronic
1077439665 11:2562059-2562081 CCCTGTCCTGGCCTTACTGCTGG - Intronic
1081650779 11:44822763-44822785 CAGGGTCCTGGTCTTCATTTGGG - Intronic
1081911057 11:46700391-46700413 CAGAGGCCTGGCCTTCCTGCAGG - Intronic
1083253861 11:61484771-61484793 GCGGGTCCTGGCCCTGCTGCTGG - Exonic
1083412327 11:62502785-62502807 CCAGCACCTGGCTTTCATGCAGG - Intronic
1083770466 11:64864206-64864228 CGGGGTCCTGGCCTCCAGCCTGG + Intronic
1083772444 11:64875842-64875864 GCCAGTCCTGGCCTTCCTGCTGG + Intronic
1083921242 11:65782149-65782171 CCGGGACCGGGCCTTCTGGCTGG - Intergenic
1084183765 11:67459558-67459580 CCAGGGCCTGCCCTTCAAGCAGG + Exonic
1084389448 11:68865578-68865600 CGGAGTCCTGTCCTTCATCCTGG - Intergenic
1085262953 11:75218794-75218816 CCAGGTCCTGGCATTCCTTCCGG + Intergenic
1090374117 11:126277067-126277089 CCGGGTCCGGTTCTTCCTGCTGG - Exonic
1091219974 11:133924865-133924887 CCGGGTTCTGGCCGTCATGCAGG - Exonic
1094754797 12:33455353-33455375 CTGGGTTCTGGACTACATGCTGG - Intergenic
1095975454 12:47938101-47938123 CCAGGTCCTGGCCTTCCTGGAGG + Intronic
1098160299 12:67643226-67643248 CTGGGTCCTGGGGATCATGCTGG - Intergenic
1100913554 12:99392145-99392167 CCTGTTCCTGGCCTTCCTGTCGG + Intronic
1101547065 12:105724674-105724696 CCAGCTCCTAGCCTTTATGCAGG + Intergenic
1101959418 12:109237451-109237473 CTGGGTCCTGGGCTGCATGCTGG + Intronic
1106401089 13:29431801-29431823 CCTGGGTCTGGCTTTCATGCTGG - Intronic
1106413964 13:29530626-29530648 CCTGGTCCTGGGCTTCATAATGG - Exonic
1108259861 13:48645796-48645818 CCAGGTCCTGGGATTCATCCAGG - Intergenic
1108570646 13:51746400-51746422 CAGGGTCCTGGCCTTACAGCTGG - Intronic
1113680555 13:112241172-112241194 CCCGGTGCTGTCCTTCATCCTGG + Intergenic
1117638814 14:57775234-57775256 TGGGGTTCTGGCCTCCATGCAGG - Intronic
1117805163 14:59483815-59483837 CAGCGTCCCGGCCTTCGTGCTGG - Exonic
1118035828 14:61864922-61864944 CGGGGTCCTGGGCTGCCTGCAGG + Intergenic
1119964771 14:78902020-78902042 CTGATGCCTGGCCTTCATGCTGG - Intronic
1202920658 14_KI270723v1_random:28296-28318 CCCCTACCTGGCCTTCATGCCGG + Intergenic
1202924272 14_KI270724v1_random:9352-9374 CCCCTACCTGGCCTTCATGCCGG - Intergenic
1126663895 15:51058063-51058085 CCAGGTCCTTGCACTCATGCAGG + Exonic
1128161181 15:65423426-65423448 CCAGGTCCTGGCCTGAATGCTGG + Intergenic
1128806247 15:70533138-70533160 CAGGGCCCTGGCCTTCAGGAAGG - Intergenic
1130093417 15:80839480-80839502 GCGGGTGCTGGCCCTCCTGCAGG - Intronic
1133073807 16:3264351-3264373 CGGGGTCCCGGCCTGCCTGCGGG + Intronic
1137983683 16:53090637-53090659 TGGGGCCCTGGGCTTCATGCCGG - Intronic
1139489700 16:67279668-67279690 CCAGGCCCTGGCCTTGTTGCAGG - Exonic
1141473099 16:84252669-84252691 CCGGGTCCTGGCTGACAGGCAGG + Intergenic
1143509313 17:7386801-7386823 CATGGTCCTGGCCTCCCTGCTGG + Intronic
1145222232 17:21098960-21098982 CCAGTTCCTGGACTTCATGAAGG - Intergenic
1146232963 17:31130407-31130429 CAGGGTGCTGGCCTCCATGTGGG + Intronic
1147150709 17:38511936-38511958 CTGGGTCCTGTCCATCCTGCAGG - Exonic
1147726700 17:42570018-42570040 CCTGGTCCTCCCCTTCATGGGGG - Exonic
1148934577 17:51154652-51154674 CTGGGTTTTGGCCTTCATTCTGG + Intronic
1152262001 17:79272354-79272376 CTGAGTCCAGGCCTGCATGCAGG + Intronic
1152620521 17:81362102-81362124 CTGGGTCCTTCCCTCCATGCAGG - Intergenic
1152889642 17:82873244-82873266 CCTGGGCCTGCCCTTCATCCTGG + Intronic
1153074495 18:1147517-1147539 CCAGGTCCTGGCCTGGATTCTGG - Intergenic
1155844978 18:30694992-30695014 CAGGGTGCTGACTTTCATGCAGG + Intergenic
1157220955 18:45828297-45828319 CCATGTCCTCCCCTTCATGCAGG + Intronic
1158741224 18:60144486-60144508 CTGGCTCCTGGCCATCTTGCTGG + Intergenic
1159098715 18:63936240-63936262 CCGGGACCTGACCTTCCTTCCGG + Intergenic
1161076469 19:2288266-2288288 CCGGGTCCAGGCCTCCCTGCAGG + Intronic
1161219187 19:3110266-3110288 CCGGATCATGGCCTGCATGGCGG - Exonic
1161323804 19:3653364-3653386 CAAGGACCTGGACTTCATGCAGG - Exonic
1161468255 19:4444010-4444032 CCCGGGCCAGGCCTTCCTGCTGG + Intronic
1162345071 19:10114072-10114094 CTGGGTCCTGGCCGCCCTGCTGG + Exonic
1162829845 19:13277600-13277622 CAGGGGCCTGGCCTTGAAGCAGG - Intronic
1163311754 19:16519168-16519190 CTCGTCCCTGGCCTTCATGCGGG + Exonic
1165062645 19:33212359-33212381 CCTGGCCCTGGCCTTCCTCCAGG - Exonic
1166112904 19:40634003-40634025 CCAGGCCCTTGCCTTCATGGGGG + Intergenic
1166942201 19:46373915-46373937 CTGGCTCCAGGCCTTTATGCAGG - Intronic
1167246028 19:48373729-48373751 CCAGCTCCTGGACTTCATCCTGG + Exonic
1167399145 19:49253333-49253355 CCTGGTCCCTGCATTCATGCAGG - Intergenic
932844430 2:75120674-75120696 CTGGGTCCTGGCTCTCCTGCTGG - Exonic
933340911 2:81025312-81025334 AGGGGTCCTGGCCTTGATGAAGG + Intergenic
933768123 2:85724990-85725012 CTGGGTCCTTGCCTCCAGGCAGG - Intergenic
935694163 2:105756673-105756695 GCAGGTCCTGGACTTCATTCTGG + Intronic
936007826 2:108906243-108906265 CCGGGCCCAGCCCTTCATGTCGG + Intronic
937675584 2:124586414-124586436 GCGGGTGCTGGCCTGCCTGCAGG + Intronic
945620044 2:212124751-212124773 CCGGGACCTCTCCTTCCTGCGGG - Exonic
948205963 2:236163213-236163235 CCGGGCCTTGGCCTCCCTGCCGG + Intergenic
948250427 2:236524086-236524108 CAGGGTCAAGACCTTCATGCTGG - Intergenic
948355642 2:237374898-237374920 CCCGGTCCTGGCCCACATCCAGG + Exonic
949021822 2:241745038-241745060 CCAGGACCTGGCCTTCCTGGTGG + Intronic
1169881384 20:10350980-10351002 ATGGGTTCTTGCCTTCATGCAGG - Intergenic
1171378982 20:24718857-24718879 CTGGGTCCTTTCCTTCATGCAGG + Intergenic
1172038722 20:32028934-32028956 CCAGCTCCTGGCCCTCAGGCAGG - Intronic
1172748283 20:37230479-37230501 CCTGGTCCTGTCCTGCACGCAGG + Intronic
1172815306 20:37681570-37681592 CTGGGCCCTGGCCTTGGTGCTGG - Intergenic
1173903563 20:46608911-46608933 CCGGGTTCTGTCCTTCCTGCCGG - Intronic
1174497647 20:50959589-50959611 CGGGGTCCTGGGCTGCCTGCAGG + Exonic
1176030147 20:63007777-63007799 TGGGGTTCTGGCCTTCATGCGGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1179584580 21:42366441-42366463 CCTGGTCCTGGTGTCCATGCTGG - Exonic
1183383844 22:37503822-37503844 CTGGGGCCTGGCTTTCTTGCCGG + Intronic
1183817153 22:40312149-40312171 CCGGTTCTTGGCCTAGATGCTGG + Intronic
1185157972 22:49205577-49205599 ACGTGGCCTGACCTTCATGCTGG + Intergenic
1185329522 22:50245912-50245934 CCGAGTCCTGGCCCTCCTGGAGG - Exonic
952335688 3:32401489-32401511 CAGGGTCCTGGCGTGCTTGCGGG - Intronic
954660454 3:52224255-52224277 CCTGGTGCAGGCCATCATGCTGG - Exonic
957080918 3:75634803-75634825 CCCCTACCTGGCCTTCATGCCGG - Intergenic
961269820 3:125680408-125680430 CCGGGGCCTGGGCATCATCCTGG - Intergenic
962395848 3:135014816-135014838 CCTGGAGCTGGCTTTCATGCAGG + Intronic
966982994 3:185154475-185154497 CTGGGTTCTGGCCTTGTTGCAGG - Intergenic
967948419 3:194822365-194822387 CCGTGTCCTGGCCCTGCTGCTGG - Intergenic
968468950 4:768432-768454 ACCGATCCTGGCTTTCATGCTGG - Exonic
973849324 4:54945625-54945647 CCGGGTCCTGTGCTTGATCCTGG - Intergenic
978923763 4:114217666-114217688 CCGGGTGCTGGCTTCCATGTGGG - Intergenic
980428551 4:132658822-132658844 CGGGGTCCTGCCCTTCTTGGAGG - Intergenic
983124391 4:163932587-163932609 CTTGGTCATGGCCTTCATGCAGG - Intronic
984993613 4:185406213-185406235 CTGGGTTCTTGCCTTCTTGCTGG + Intronic
986330162 5:6712205-6712227 ACGGGACCTGGCCTTCGTACAGG - Intergenic
987794054 5:22605588-22605610 CCTGGACCAGGCCTTCATGTTGG - Intronic
997470592 5:134114984-134115006 CCTGCTCCTCGCCTTCATCCTGG - Exonic
999711570 5:154322774-154322796 CTGGATCCTGGCCTCCCTGCAGG + Intronic
1007428338 6:41761405-41761427 CCAGGTCCTGGTCCTCATGAGGG + Intergenic
1012199624 6:96389482-96389504 CCAGGTCCTGGACTTTATACTGG + Intergenic
1015224513 6:130841576-130841598 CTGGGTCCTGGCCATCTGGCAGG - Intronic
1015514971 6:134074273-134074295 CCGGGGCCTGGCCCTCTTGGAGG + Intergenic
1018080598 6:160256483-160256505 CAATCTCCTGGCCTTCATGCTGG - Intronic
1018712718 6:166508235-166508257 CCTGATCCTGGACTTCCTGCGGG - Exonic
1023849252 7:44141051-44141073 CCGGGTCCCCGCCTTCCTGCTGG + Exonic
1025992423 7:66505949-66505971 CCGGATCATGGCCTGCATGGCGG + Intergenic
1026289558 7:68994150-68994172 CCTGTTTATGGCCTTCATGCCGG + Intergenic
1028734277 7:94189593-94189615 CAGGGTGCTGGCCTCCATGCAGG + Intergenic
1032002824 7:128276326-128276348 CCTGGGCCTGGCCATCATGGTGG + Intergenic
1034052880 7:148001290-148001312 CTGGGTCCTAGCCTTCAGCCTGG + Intronic
1034270187 7:149799918-149799940 CAGGGTCCTGGCCTCCATCTGGG - Intergenic
1036427232 8:8655776-8655798 CAGGGTCCAGGACCTCATGCTGG - Intergenic
1045111465 8:98941726-98941748 CCTGTCCCTGGCCTTCATCCCGG + Intronic
1046407222 8:113790493-113790515 CAGGGACCTGGCACTCATGCTGG - Intergenic
1048922014 8:139239892-139239914 CCAGGGCCTGATCTTCATGCTGG - Intergenic
1048983486 8:139715928-139715950 CTGGGGCCAGGCCTACATGCTGG + Intergenic
1049384737 8:142337492-142337514 CCGAGTCCTGGCTTTATTGCTGG - Intronic
1049495401 8:142928691-142928713 CCTGGACCTGGTCTTCATGCAGG + Intergenic
1049755808 8:144310890-144310912 CCGGATCCTGGCATCCATCCTGG - Intronic
1051219186 9:14830760-14830782 AAGGGTCTTGGCCCTCATGCCGG - Intronic
1052173395 9:25428166-25428188 CAGGGTGCTGGCCTCCATGCAGG - Intergenic
1059460200 9:114424753-114424775 CCAGGTCCCTGCCCTCATGCGGG - Intronic
1061712909 9:132499774-132499796 CTGGGTCCTGGCCTTATAGCAGG + Intronic
1061925302 9:133803305-133803327 CCAGTTCGTGGCCTTCCTGCAGG + Intronic
1062389148 9:136327285-136327307 CCTGGGCCTGGCCTTGCTGCTGG - Intergenic
1062483992 9:136765105-136765127 CCGGTCCCTGGCCTGCTTGCTGG - Intronic
1194461754 X:94178320-94178342 CCAGGACCTGGCCTTGGTGCTGG - Intergenic
1195060673 X:101191354-101191376 CTTGGTCCCGGCCTTCATGCAGG + Intergenic
1195548470 X:106139250-106139272 GTGGGTGCTGGCCTCCATGCAGG - Intergenic
1198658753 X:138943355-138943377 CCGTGTACTGTCCTACATGCAGG - Intronic
1200017993 X:153180294-153180316 CAGGGTCCTGACCCTAATGCCGG - Intronic
1200816848 Y:7542184-7542206 CTGGAGCGTGGCCTTCATGCAGG + Intergenic