ID: 918043748

View in Genome Browser
Species Human (GRCh38)
Location 1:180928559-180928581
Sequence TACCCAGGGCAGCCGGTGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918043734_918043748 17 Left 918043734 1:180928519-180928541 CCCGGCCCCTCCGTGCCAGCCAT 0: 1
1: 0
2: 1
3: 30
4: 246
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043739_918043748 7 Left 918043739 1:180928529-180928551 CCGTGCCAGCCATGACATCGTGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043740_918043748 2 Left 918043740 1:180928534-180928556 CCAGCCATGACATCGTGCCCACC 0: 1
1: 0
2: 1
3: 10
4: 95
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043737_918043748 11 Left 918043737 1:180928525-180928547 CCCTCCGTGCCAGCCATGACATC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043735_918043748 16 Left 918043735 1:180928520-180928542 CCGGCCCCTCCGTGCCAGCCATG 0: 1
1: 0
2: 1
3: 23
4: 349
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043741_918043748 -2 Left 918043741 1:180928538-180928560 CCATGACATCGTGCCCACCATTA 0: 1
1: 0
2: 0
3: 1
4: 68
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043733_918043748 23 Left 918043733 1:180928513-180928535 CCAGGACCCGGCCCCTCCGTGCC 0: 1
1: 0
2: 1
3: 45
4: 448
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043738_918043748 10 Left 918043738 1:180928526-180928548 CCTCCGTGCCAGCCATGACATCG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159
918043736_918043748 12 Left 918043736 1:180928524-180928546 CCCCTCCGTGCCAGCCATGACAT 0: 1
1: 0
2: 1
3: 9
4: 163
Right 918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG 0: 1
1: 0
2: 1
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918043748 Original CRISPR TACCCAGGGCAGCCGGTGAG TGG Exonic
900103452 1:972410-972432 TTCCCAGGGTCGCAGGTGAGGGG + Exonic
900104226 1:975463-975485 CACCCAGGGCTCCCGGGGAGGGG + Exonic
900137584 1:1124961-1124983 TCCCCAGGGCAGCCGCTGAGCGG + Intergenic
900224947 1:1528625-1528647 TTCCCGAGGCAGCCGGTGTGTGG - Intronic
901765022 1:11494486-11494508 TAGCCAGGACATCCGGAGAGCGG + Intronic
903036183 1:20494108-20494130 TAGCTAGGGAAGACGGTGAGGGG + Intergenic
903642240 1:24867963-24867985 TCCCCAGTGCAGTTGGTGAGAGG + Intergenic
905746516 1:40422936-40422958 TACCCAGAGCAGATGGGGAGAGG - Exonic
906313026 1:44767319-44767341 GGCCCAGGGCAGCTGGGGAGGGG + Exonic
906695127 1:47818330-47818352 TACTCAGGGGACCAGGTGAGTGG - Intronic
907266258 1:53263349-53263371 GAGCAAGGGCAGCTGGTGAGGGG - Intronic
909975207 1:82037788-82037810 TCCCCATGGCAGCAGGTGAGAGG + Intergenic
911409807 1:97488887-97488909 TGCCCAGAGCAGCAGCTGAGAGG - Intronic
918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG + Exonic
918238011 1:182599010-182599032 TACCCAGGGCAGCCCCTTTGTGG - Exonic
919881993 1:201906940-201906962 TACCCAGGACAGCTGGTGCCAGG - Intronic
922520477 1:226246422-226246444 TACCCAGGGCAGGATGGGAGTGG - Intronic
923782876 1:237042022-237042044 TTCCCAGCGCAGCCAGTAAGTGG + Intergenic
1067092716 10:43277488-43277510 TACCCAGGGCAGAGGGAGAGAGG - Intergenic
1067295572 10:44973517-44973539 TTCCCAGGGCAGCTGGTGCTTGG - Intronic
1069822341 10:71235602-71235624 TTCCCAGGCCAGACGGTGGGAGG + Intronic
1071458191 10:85867455-85867477 CACCCAGTGCAGCGGGAGAGGGG - Intronic
1073217735 10:101845762-101845784 TACACATGGCAGCCTGTTAGTGG + Exonic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1074957638 10:118407939-118407961 TACCCACTGCAGCCAGTGAGAGG + Intergenic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076662040 10:132062143-132062165 AAACCTGGGCAGCCAGTGAGTGG + Intergenic
1078896324 11:15600324-15600346 CAGCCAGGGAAGCAGGTGAGAGG - Intergenic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1080641231 11:34159710-34159732 GACCCAGGGCAGCAGGAAAGGGG - Intronic
1080878765 11:36300274-36300296 TACTCATGGCAGAAGGTGAGGGG + Intronic
1081622662 11:44628172-44628194 TAAACAGTGCAGCCGGGGAGGGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082791564 11:57349565-57349587 TACACAGGGAAGGCGGTGATGGG + Intronic
1083553531 11:63608366-63608388 TGCCCAGGGCAGCCTGAAAGTGG + Intronic
1084910378 11:72382596-72382618 TACCTGGGTCAGCAGGTGAGTGG - Intronic
1085204068 11:74719855-74719877 GACCCAGGGCTGGAGGTGAGTGG - Intronic
1087443020 11:98208845-98208867 TACCTAGGGCAGCCGCTGTGAGG - Intergenic
1087675475 11:101157114-101157136 TGCACATGGCAGCAGGTGAGAGG - Intergenic
1090712041 11:129395821-129395843 TGCCCAGGTCACCCAGTGAGCGG - Intronic
1091097782 11:132840348-132840370 TTCCCAGGGCAGCAGCTGACGGG + Intronic
1091879844 12:3968175-3968197 TTCCCAGGACACCAGGTGAGTGG + Intergenic
1095684430 12:45016492-45016514 AACCCAGAGCAGACCGTGAGAGG + Exonic
1097152159 12:56987111-56987133 TACCCAGGGCTGCTGGGAAGGGG + Intergenic
1101594508 12:106152109-106152131 TATCAAGGGCATCCAGTGAGAGG + Intergenic
1103856270 12:123972979-123973001 TACCCAGGGCAACCGCAGTGCGG - Intronic
1104841291 12:131827341-131827363 TACCCAGGGAAGCGGGGGGGGGG + Intergenic
1110176412 13:72561442-72561464 TATCCAGGGCAGAGGGTGTGAGG + Intergenic
1111025432 13:82514875-82514897 TTCACAGGGCAGCAGGAGAGAGG + Intergenic
1113946132 13:114044542-114044564 CGCCCAGGGCTGCCGGTGGGAGG - Intronic
1114823780 14:26052921-26052943 TACTCATGGCAGAAGGTGAGGGG - Intergenic
1120295307 14:82633007-82633029 TTCCCAGGGGAGTGGGTGAGAGG - Intergenic
1120592806 14:86395371-86395393 TACTCATGGCAGAAGGTGAGGGG + Intergenic
1121743443 14:96269517-96269539 TGCACAGTGCAGCCGGTCAGAGG + Intergenic
1122393582 14:101407292-101407314 TGGCCAGGGCAGTCAGTGAGGGG - Intergenic
1127269338 15:57386578-57386600 TACACAGAGCAGCCTGTGAGTGG - Intronic
1128382643 15:67124803-67124825 GGCACAGGGCAGCCGGGGAGAGG + Intronic
1128892761 15:71345370-71345392 CACCCCGGGCTGCCTGTGAGAGG + Intronic
1129887630 15:79049599-79049621 AACACAGGTCAGCCTGTGAGGGG + Intronic
1132330447 15:101008856-101008878 TACCCAGGGCAGTCTGAGATGGG - Exonic
1132478379 16:153716-153738 AGCCCAGGGCAGCCTGGGAGGGG + Intronic
1132480464 16:164306-164328 AGCCCAGGGCAGCCTGGGAGGGG + Intronic
1132497926 16:272646-272668 CACCCAGGGCAGCAGGTGGGAGG + Intronic
1132894381 16:2221246-2221268 TACCCAGGGCTGGCAGGGAGGGG + Intergenic
1133024177 16:2980498-2980520 TCCCCAGTGCAGCCCGTCAGGGG + Exonic
1133324748 16:4936155-4936177 TTCCCAGGGCGGCCTGGGAGGGG - Intronic
1134207591 16:12250537-12250559 TACCCAGTGGAGCAAGTGAGAGG - Intronic
1135026292 16:19001887-19001909 TTCCCATAGCAGCTGGTGAGAGG + Intronic
1140753438 16:78046401-78046423 TCCCCAGTGCAGCCGATGACAGG + Intronic
1141173446 16:81704735-81704757 TAGGCAGGGAAGCGGGTGAGGGG - Intronic
1141895784 16:86957874-86957896 TTATCAGGGCAGCCGGTGAGGGG - Intergenic
1141961666 16:87413149-87413171 TTCCCGGGGCAGCTGGTGATGGG + Exonic
1142570388 17:869866-869888 TACTCTGGGCAGCAGGTCAGCGG - Intronic
1143376533 17:6470673-6470695 CACCCAGGGCCGCCGCTCAGTGG + Intronic
1143587654 17:7858624-7858646 TACCTCAGGCAGCCGGTCAGCGG - Exonic
1147262542 17:39217068-39217090 TGCCCAGGCAAGACGGTGAGCGG - Exonic
1147888642 17:43701548-43701570 TTCCGAGGGCAGCGGGCGAGCGG + Intergenic
1148496257 17:48054982-48055004 GCCCCAGGGCAGCCGGTGCCGGG - Intronic
1148693414 17:49545632-49545654 TAGCCAGAGCAGCTGGTGAGAGG - Intergenic
1148734102 17:49854931-49854953 TACACAGGGCAGGGGGAGAGAGG + Intergenic
1150103313 17:62442912-62442934 TATCCTGTGCAGCCAGTGAGGGG - Intronic
1150286959 17:63960136-63960158 GACCCAGGGCAGCTGGTGCCTGG - Intronic
1151578223 17:74963398-74963420 AACCCAGGGCAGGTGGTGTGGGG + Intronic
1151906941 17:77054883-77054905 CTCCCAGGGAAGCAGGTGAGTGG + Intergenic
1152177112 17:78795108-78795130 TAGCCTGGGCAGCGGTTGAGGGG - Intronic
1152593228 17:81223633-81223655 TCCCCAGGGCTCCCGGAGAGAGG - Intergenic
1152612703 17:81323435-81323457 TTCCCAGGGCAGGTGGGGAGGGG - Intronic
1153901503 18:9621387-9621409 AGCCAAGGGCAGCTGGTGAGAGG - Intergenic
1154420415 18:14223572-14223594 TAGGCAGGGCAGCCGGGCAGAGG - Intergenic
1157567852 18:48691829-48691851 TACCTGGGGCAGCAAGTGAGGGG - Intronic
1161478667 19:4499864-4499886 TCCCTGGGGCAGCCAGTGAGGGG + Intronic
1161674313 19:5635624-5635646 TACCCAGGGCTGCATGTGGGTGG - Intronic
1161793621 19:6374634-6374656 TACCCAGGGCACAGGGTGGGCGG - Intronic
1165527270 19:36366681-36366703 TACCCTGGGCAGTAGGTGGGTGG + Intronic
1165621846 19:37254686-37254708 TTCCCAGGGCAGATGCTGAGTGG + Intergenic
1166122043 19:40691952-40691974 GACCCAGGGCAGACGGGGAAGGG + Exonic
1167041798 19:47027175-47027197 CACCCAGGGAAGTCGGGGAGAGG - Intronic
925214523 2:2083262-2083284 TACCCAGGGCAAGAGCTGAGTGG - Intronic
925622672 2:5808955-5808977 TTCCCAGGACAGGCTGTGAGGGG - Intergenic
927673985 2:25091236-25091258 GGGCCAGGGCAGCCTGTGAGTGG - Intronic
928455732 2:31420032-31420054 TGCCTAGGTCAGCAGGTGAGTGG + Intergenic
932458856 2:71869186-71869208 CAACCAGGGCAACCAGTGAGTGG + Intergenic
934890439 2:98063662-98063684 TACCCAGAGCAGCAGCTCAGAGG - Intergenic
937779424 2:125820285-125820307 TACCCAAGGCAGCAGAGGAGGGG + Intergenic
937887183 2:126907928-126907950 AGCCCAGGGCAGCCCGTGGGAGG + Intergenic
938381105 2:130837088-130837110 TCCCCTGGGCACCCGGTGGGTGG + Intronic
948445069 2:238026162-238026184 TGCCCCGGGCAGCCGGGCAGGGG - Intronic
948589243 2:239038826-239038848 TACCCTGGGAACCCGGTAAGTGG - Intergenic
948607204 2:239143748-239143770 GACCTAGGGAAGCCGGGGAGGGG - Intronic
948759044 2:240179297-240179319 TCGGCAGGGCAGCCGTTGAGAGG + Intergenic
1172025630 20:31946374-31946396 TGTCCGGGGCAGCCTGTGAGTGG - Intronic
1172092473 20:32443760-32443782 TTCCCTGGGCAGCCTGGGAGTGG - Exonic
1173800758 20:45892995-45893017 GACCTAGGGCAGCCGGTGGTGGG - Intronic
1176019930 20:62957358-62957380 GACTCAGGGCAGCCCTTGAGTGG - Intronic
1179435670 21:41360562-41360584 TTCCCAGGGCTGCTGGTGAGGGG + Intergenic
1179524958 21:41969904-41969926 TACTCAGGGCAGGGGGTTAGTGG + Intergenic
1179544923 21:42107505-42107527 TAGCCTGGCCAGCAGGTGAGGGG - Intronic
1179628162 21:42660125-42660147 CACCCAGGGGAGCAGGTGATTGG - Intronic
1184673528 22:46027962-46027984 CACCCACGGCAGCCGGAGAGGGG - Intergenic
1184726805 22:46351859-46351881 TCCCCGGGGCAGCTGGTGTGAGG + Intronic
1185278023 22:49958063-49958085 GGCCCAGGGCAGAGGGTGAGAGG + Intergenic
950024974 3:9813953-9813975 TACCAAGGGCAGCGGGGAAGGGG - Intronic
953149828 3:40314758-40314780 AACCCAGTGCAGCTGGTGTGTGG - Intergenic
953369615 3:42376316-42376338 TTCCCAGGGCAGAGGGTGGGGGG - Intergenic
953570701 3:44069144-44069166 TACCTAAGGCAGACTGTGAGGGG + Intergenic
953883425 3:46702887-46702909 GCCTCAGGGCAGCCTGTGAGGGG - Intronic
953911796 3:46896911-46896933 TACTCAGGGCAGGCATTGAGTGG + Intronic
954136358 3:48583892-48583914 GAGCCTGGGCTGCCGGTGAGGGG - Exonic
960125945 3:113998576-113998598 TAGTCAGGTCAGCTGGTGAGTGG - Intronic
962684085 3:137829841-137829863 TACCCATGGCAGAAGGTGACAGG + Intergenic
962848260 3:139289319-139289341 TACCCAGGGAAGCCAGTGATGGG + Intronic
966595159 3:181719433-181719455 TCCCCAGGGCAGCCGGCGGGAGG - Intergenic
968622363 4:1609578-1609600 TTCACAGGGCAGCAGGGGAGAGG - Intergenic
968740790 4:2330821-2330843 GACCCAGGGCAGCGGGTGCGTGG + Intronic
971386201 4:26142432-26142454 TTCACTGGGCAGCTGGTGAGAGG + Intergenic
982331313 4:154184851-154184873 TTCCCATGGCAGCAGGAGAGAGG + Intergenic
984807920 4:183768386-183768408 TACCCTGGGCAGACACTGAGAGG - Intergenic
985784099 5:1885298-1885320 TTCCCAGGGCAGCCAGTACGTGG + Intronic
990597142 5:57323225-57323247 CTCCCAGGGCAGCCAGTGGGAGG - Intergenic
998051012 5:139035486-139035508 TTGCCAAGGCAGCCGGTGACTGG - Intronic
1002667800 5:180839275-180839297 TCACCAGGGCAGCATGTGAGAGG - Intergenic
1003053210 6:2797960-2797982 TGCCCTGGGCAGGCTGTGAGAGG + Intergenic
1006183418 6:32167243-32167265 TACTCAGCGTGGCCGGTGAGTGG + Exonic
1008909010 6:56713201-56713223 GACCCTGGGCAGCTGGTGAGTGG + Intronic
1010908669 6:81525116-81525138 TACCAAGGACTGTCGGTGAGTGG + Intronic
1010971751 6:82270193-82270215 GAAACAGAGCAGCCGGTGAGTGG + Intergenic
1014955383 6:127608679-127608701 TACCCAGGGAAGTAGGTAAGAGG + Intergenic
1017574937 6:155791720-155791742 TACACAGAGAAGCCAGTGAGTGG - Intergenic
1017875915 6:158524199-158524221 CACCCAGGGCTGCCGGGAAGGGG - Intergenic
1018950340 6:168374749-168374771 TGCCCTGGGCAGCCGTGGAGTGG - Intergenic
1024357225 7:48426554-48426576 TACCCAGGGCATTGGGTGGGAGG + Intronic
1027125718 7:75555421-75555443 GACCCAGCGCAGCTGATGAGAGG + Exonic
1028348630 7:89815624-89815646 TACTCAGGGCTGCTGCTGAGTGG - Intergenic
1029422661 7:100479153-100479175 GACCCAGGGGAGCCGAGGAGCGG - Exonic
1029981794 7:104885888-104885910 GAGCCAGGGCAGCTGGTGATAGG - Intronic
1032079007 7:128849385-128849407 ATGCCAAGGCAGCCGGTGAGGGG + Exonic
1032084018 7:128874288-128874310 GACCCTGAGCAGCCGGTGAGTGG - Intronic
1034557120 7:151857336-151857358 TGCCCAGGTCCGCCTGTGAGAGG + Intronic
1036754275 8:11462006-11462028 TGCCCAGTGCAGCCTGTAAGTGG + Intronic
1037616586 8:20524587-20524609 TCTCCAGGGCAGGTGGTGAGGGG + Intergenic
1041371622 8:57166695-57166717 CACCCAGTTCAGCCAGTGAGAGG - Intergenic
1046415990 8:113914707-113914729 TACCCATTCCAGACGGTGAGGGG - Intergenic
1049601108 8:143508096-143508118 TAGCCAGTGCAGCCTCTGAGAGG + Intronic
1049746423 8:144265132-144265154 CGCCCAGGGGAGCAGGTGAGGGG + Intronic
1056816076 9:89802131-89802153 TACTCAGGGCATCCAGAGAGAGG - Intergenic
1057535942 9:95906470-95906492 TACCCATGGCAACAGGTGGGAGG + Intronic
1058564350 9:106265765-106265787 AATCCAGGGCAGCAAGTGAGAGG + Intergenic
1059335445 9:113565810-113565832 TCCCCAGGGCAGCCATTGATAGG + Intronic
1060782433 9:126422602-126422624 TATCCTGGGCCGCCAGTGAGGGG + Intronic
1061743385 9:132723150-132723172 CACCCAGGAAAGCAGGTGAGAGG - Intergenic
1062326838 9:136016570-136016592 GACCCAGGCCAGCAGGAGAGCGG - Intronic
1062342719 9:136100861-136100883 CACCCAGTGCAGCCGGTGGTGGG - Intergenic
1190443260 X:50496904-50496926 TAACTAGGGCAGCAGGAGAGAGG + Intergenic
1191937558 X:66441591-66441613 TACCCAGGCAAGGTGGTGAGTGG - Intergenic
1192156790 X:68752890-68752912 TTGCCAGGCCAGCAGGTGAGAGG + Intergenic
1197870410 X:131058317-131058339 TACTTAGGGCCGCCGGTGCGGGG + Exonic
1201059798 Y:10035892-10035914 TGCCCAGGGCAGAGGATGAGAGG - Intergenic