ID: 918045626

View in Genome Browser
Species Human (GRCh38)
Location 1:180939305-180939327
Sequence CTGAAGTTCTGGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 2, 3: 57, 4: 329}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918045626_918045633 17 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045633 1:180939345-180939367 CTCCTGGACATCTCCATCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 157
918045626_918045632 16 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045632 1:180939344-180939366 TCTCCTGGACATCTCCATCAGGG 0: 1
1: 1
2: 1
3: 19
4: 172
918045626_918045636 26 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045636 1:180939354-180939376 ATCTCCATCAGGGGGTCTGATGG 0: 1
1: 0
2: 0
3: 15
4: 163
918045626_918045637 27 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045637 1:180939355-180939377 TCTCCATCAGGGGGTCTGATGGG 0: 1
1: 0
2: 0
3: 16
4: 123
918045626_918045634 18 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045634 1:180939346-180939368 TCCTGGACATCTCCATCAGGGGG 0: 1
1: 0
2: 1
3: 14
4: 122
918045626_918045631 15 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045631 1:180939343-180939365 TTCTCCTGGACATCTCCATCAGG 0: 1
1: 0
2: 0
3: 34
4: 229
918045626_918045628 1 Left 918045626 1:180939305-180939327 CCATCTGCTCTCCAGAACTTCAG 0: 1
1: 1
2: 2
3: 57
4: 329
Right 918045628 1:180939329-180939351 GCTGCATGCCCAGTTTCTCCTGG 0: 1
1: 0
2: 5
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918045626 Original CRISPR CTGAAGTTCTGGAGAGCAGA TGG (reversed) Intronic
900548253 1:3240774-3240796 CTGACTTTTTGGAGAACAGAGGG + Intronic
900548627 1:3242397-3242419 CTGGAGCTCTCGAGAGTAGAAGG - Intronic
900581231 1:3410674-3410696 GTGAACTTCTAGAGAGCAGGAGG + Intronic
900608962 1:3536423-3536445 CTGAAGCTCTGGGGTGCGGAGGG + Intronic
901324351 1:8357987-8358009 TTGCAGTTCTGGAGAGCTGCGGG + Intronic
902038273 1:13473418-13473440 CTGCAATGCTGGGGAGCAGAGGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903326608 1:22572493-22572515 CGGAAGTTCCCGGGAGCAGAGGG - Intronic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
904370920 1:30046907-30046929 CTGCAGTTCAGGAGAGAACACGG + Intergenic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905279156 1:36837809-36837831 CAGAAGCTCTGGATGGCAGATGG + Intronic
907350590 1:53826947-53826969 GTGAAGTTCCAGGGAGCAGAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908694951 1:66829110-66829132 AAGAAGCTCTGGAGAGAAGATGG + Intronic
909948686 1:81693149-81693171 GAGAAGTTCAGGGGAGCAGAAGG - Intronic
910525154 1:88169314-88169336 CTGAAGTTCAGGAAAACAGGAGG + Intergenic
912183539 1:107247799-107247821 CTCAAGGTCTGGATAGCTGATGG - Intronic
913443095 1:118920349-118920371 CTGAATTTTTGAAGAGTAGAAGG + Intronic
913518504 1:119624316-119624338 CTGAAGAACTGGTGGGCAGAGGG - Intronic
917136656 1:171794522-171794544 CTGAAGGTATGGAGAACAAAAGG + Exonic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
917971859 1:180213530-180213552 CTGAAAATCTGGGGAGCCGATGG - Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
919524019 1:198624812-198624834 AGGAAATTCTGGAGGGCAGAGGG + Intergenic
919668523 1:200317043-200317065 CTGATGTTATGGACAGCAGTGGG - Intergenic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
922669906 1:227501762-227501784 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
923478579 1:234360571-234360593 CTGGAGTTATGTAGAGCAAATGG - Intergenic
1063161721 10:3423445-3423467 CTGCAGCTCTGCAGAGCTGAGGG - Intergenic
1063437867 10:6049160-6049182 CTGAAGGCCTGAGGAGCAGAGGG + Intronic
1064135080 10:12743597-12743619 CTGAAGTTCTGTAGTGGTGATGG - Intronic
1064561830 10:16601221-16601243 CTGAAGTTCTGGAGACATGGAGG - Intronic
1067222301 10:44352981-44353003 GTGAACTTCAGGAGAGCATAGGG - Intergenic
1067293042 10:44958390-44958412 CTCGAGTTCTGGAGAGCCCAGGG + Intergenic
1067689436 10:48491990-48492012 CTTAAGTTCAGGAGCTCAGAGGG - Intronic
1067842858 10:49695625-49695647 TTGAAGTTCTGGGGTGCAGGAGG - Intronic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1071595684 10:86922087-86922109 CTGAACTCATGGAGAACAGAAGG - Intronic
1072924540 10:99605051-99605073 CTGCTGTTCTGTAGAGCAGGAGG - Intergenic
1073622987 10:105068025-105068047 CTGAAATTCTGGAGAGAGTAGGG - Intronic
1073771711 10:106742217-106742239 CTGAAGTACTTGGGACCAGAAGG + Intronic
1073789150 10:106921985-106922007 CAGAAGTTCAGCAGATCAGAGGG - Intronic
1074048719 10:109863339-109863361 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
1074120667 10:110492056-110492078 CTGAAGTTTTAGAGAAGAGAAGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075351597 10:121729529-121729551 CAGAAATCCTGGAGCGCAGAGGG + Intergenic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1075678964 10:124318829-124318851 TTGAATCTCTGGGGAGCAGAGGG + Intergenic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1079314811 11:19398600-19398622 CAGAAGTTCATGAGAGCAGAGGG - Intronic
1079332607 11:19546231-19546253 ATGGATTTCTGAAGAGCAGATGG + Intronic
1080196186 11:29612219-29612241 CTGAAATTCTGAAGCTCAGAAGG + Intergenic
1081721310 11:45290792-45290814 CTGAAATTGTTGACAGCAGAAGG + Intergenic
1082081247 11:48013933-48013955 CTGAAGTTGGGCAGAGCAGGTGG + Intronic
1084062371 11:66684787-66684809 TTGATCTACTGGAGAGCAGACGG + Intergenic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1086106320 11:83151516-83151538 CTGGAGTGCTGGAGTGCAGGTGG + Intergenic
1086594420 11:88554067-88554089 TTACAGTTCTGGAGATCAGAAGG + Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089196400 11:116696199-116696221 CTGAAGGTCTGGAGAGGGTAAGG - Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1090646724 11:128772516-128772538 TTAAAGTTTTGGAGAGCAGTTGG - Intronic
1090912591 11:131134467-131134489 CTAAAATTCAGGGGAGCAGAAGG + Intergenic
1090923737 11:131231435-131231457 CTGAGGTTTTGGGGAGCTGAAGG - Intergenic
1090976559 11:131684714-131684736 CTGCATTCCTAGAGAGCAGAGGG + Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093203174 12:16214507-16214529 CCCAACTTCTGGGGAGCAGAAGG + Intronic
1094019516 12:25899343-25899365 TTGAAGTTCAGCAGAGCTGAAGG - Intergenic
1094814740 12:34171658-34171680 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1095102192 12:38196924-38196946 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1095549017 12:43410717-43410739 TTGGATTTCTGGAAAGCAGAAGG + Intronic
1096673527 12:53214228-53214250 CTGGAGTTCTGCAGAGGGGAGGG + Exonic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1102301591 12:111775400-111775422 CTGAAGTCCTGGTGAGGAGAGGG - Intronic
1103919054 12:124390016-124390038 CTAAAAATCTGGGGAGCAGAAGG + Intronic
1104087965 12:125493313-125493335 GGGAAATTCTGGAGGGCAGAAGG - Intronic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1105613290 13:21988193-21988215 TTGAATTTCAGGAGAGCACATGG - Intergenic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106284076 13:28303763-28303785 TTGCAGTTCTGGAGGCCAGAAGG - Intronic
1106499346 13:30312092-30312114 CTGAAGGGCTGGAGATCAAAGGG - Intergenic
1107023378 13:35774857-35774879 CTGGATTTGTGGGGAGCAGAGGG - Intronic
1107042484 13:35964171-35964193 CAGAAGTTCTGCAGAGAAAATGG - Intronic
1110497498 13:76186377-76186399 CTGAAGCTTTGGAGAGCTAATGG + Intergenic
1110688684 13:78405513-78405535 CTGAAGTCCTGGAAAACTGAAGG + Intergenic
1112007445 13:95266430-95266452 CTTAAGTTCAGGAGGCCAGAAGG - Intronic
1112150285 13:96752443-96752465 ATGAAGTTTTGGAGAGAATATGG - Intronic
1113252253 13:108466721-108466743 CTGAAGGTTTGGCGAGAAGAAGG + Intergenic
1116965423 14:51009938-51009960 CTGACTTTCTGGCCAGCAGAAGG + Intronic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1119249855 14:73142683-73142705 CTGAAGTGCTGATGAGTAGAAGG + Intronic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121403482 14:93703289-93703311 TGGAAGTTCTGGAGACCAGAAGG + Intronic
1121796156 14:96737096-96737118 CTGATGTTCATGTGAGCAGAAGG + Intergenic
1123711491 15:22990985-22991007 TTGAAGTTCTGGAGGACAGAAGG - Intronic
1124948913 15:34298094-34298116 CTGAACTTCTTGAGAGCAAATGG - Intronic
1127707701 15:61563414-61563436 ATGAAGTTCTGCAGAAGAGAAGG + Intergenic
1128219534 15:65958467-65958489 CAGAAGTTCTGAACAGCACATGG - Intronic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1129105066 15:73301414-73301436 CTGAAGTGCAGGAGACCACAAGG + Exonic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129900267 15:79142657-79142679 CTGAACTTCTGGAGAGTGGGTGG + Intergenic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1130958442 15:88643791-88643813 CTGAAATGCTGGGGACCAGAAGG + Intronic
1131340887 15:91599530-91599552 ATAAAGCTCTGGAGAGCAGACGG + Intergenic
1132060279 15:98687006-98687028 CTGAAGGTTTTGAGAGGAGAGGG + Intronic
1132764508 16:1527369-1527391 CTGGAGGTCTGCCGAGCAGAGGG + Intronic
1133052411 16:3124618-3124640 CTGCAGTCCTAGAGAGCATACGG + Intergenic
1133728918 16:8561370-8561392 AAGAAGTTCTGTAAAGCAGATGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1135302581 16:21343841-21343863 ATCAAGTTCTTAAGAGCAGAGGG + Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1136299341 16:29323057-29323079 ATCAAGTTCTTAAGAGCAGAGGG + Intergenic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1137849972 16:51731865-51731887 CTGAATTTCTGGAGCGGACAGGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138712583 16:58986355-58986377 CTCAGGCTCTGGAGAGCACATGG - Intergenic
1139939972 16:70598202-70598224 AGGAAGTTCTGGGGGGCAGACGG - Intronic
1140281842 16:73562253-73562275 CTGAAGTTCTGAATTGCAAAGGG + Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142506790 17:369441-369463 CTGAAGCCCTGGAAAGCAGGAGG - Intronic
1143727708 17:8860771-8860793 CTGAAGCCCTGGGGAGCACATGG - Intronic
1143906767 17:10215496-10215518 CAGTAATTCTGGAGAGCAGCTGG - Intergenic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1146184118 17:30713796-30713818 CTGATGTTCAGTACAGCAGACGG + Intergenic
1149144074 17:53468769-53468791 TTGAAGATCTGGAGAGGGGAGGG + Intergenic
1150181367 17:63124439-63124461 CTACAGTTCAGGAGAGCAAAAGG - Intronic
1150250965 17:63704298-63704320 CTGGGCTTCGGGAGAGCAGAGGG - Intronic
1150704522 17:67475141-67475163 ATGAAGTTCTGGTTCGCAGAGGG + Intronic
1151783518 17:76263562-76263584 CTAAAGGTCTGCAGAACAGAAGG - Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152749612 17:82056614-82056636 CTGAAATACTGCAGGGCAGAGGG - Exonic
1158169457 18:54580343-54580365 CTAAAGTGCTGGTAAGCAGAAGG - Intergenic
1159611063 18:70526182-70526204 CTGAACCACTGGAGAGAAGACGG + Intergenic
1161845062 19:6707530-6707552 CTGAAGTTCTGCAGGGCAGGCGG + Exonic
1162392499 19:10397997-10398019 CTGAGGTTCAGGAGAGGTGATGG - Intronic
1163741826 19:19019021-19019043 CTGATGGTATTGAGAGCAGAGGG - Intronic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1165560908 19:36678800-36678822 CTGGAGTGCTGGAGTGCAGTGGG - Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166993002 19:46704483-46704505 CTGAAGAGCTGGTGAGGAGATGG - Exonic
1167487852 19:49773605-49773627 CTCACGTTCTAGAGAGGAGATGG + Intronic
1167703638 19:51065667-51065689 CTGAAGTTCTAGACAGCTGGCGG - Intergenic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1167852497 19:52212852-52212874 CAGAAGGACGGGAGAGCAGAGGG - Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925493266 2:4419183-4419205 CCTGAGTTCTGGAGGGCAGAGGG + Intergenic
926046082 2:9710684-9710706 CCGAAGTGCTGGAGTGCAGTGGG + Intergenic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
926552422 2:14316375-14316397 CTGACGTTCTTCAGAGGAGATGG - Intergenic
927197381 2:20557956-20557978 CCCAAGTTCTGCAAAGCAGAGGG + Intergenic
927441483 2:23121574-23121596 CTGCAGCACTGAAGAGCAGAGGG - Intergenic
927617876 2:24618460-24618482 CTGAAGGTCTTCAGACCAGATGG - Intronic
927686846 2:25177216-25177238 CTGAAGCACTGCAGAGGAGAGGG + Intergenic
928240156 2:29579045-29579067 TTGATGTTCTGGAGAGCACCTGG + Intronic
928603622 2:32924504-32924526 CTGAGGATCCGGAGAGTAGAGGG + Intergenic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932097717 2:68866381-68866403 TTGAAGTGCTGGAGAGCAAAGGG - Exonic
935601173 2:104922954-104922976 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
936985096 2:118301763-118301785 TTGAAGCTCTGGAAGGCAGAAGG + Intergenic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
937111696 2:119371562-119371584 CTGAAGCACTGGAGAGTACATGG - Intronic
938772006 2:134508744-134508766 CTGGAGTTCAGGAGAGTTGAGGG - Intronic
939908738 2:147952718-147952740 CTGAACTTCTTGAGAGCAGTCGG - Intronic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
941490371 2:166136495-166136517 CTGCTGTCCTAGAGAGCAGAGGG - Intergenic
941747582 2:169103480-169103502 CTGAAGTCCAGGTTAGCAGAAGG + Intergenic
943741045 2:191409439-191409461 CTGAACTACTTGAGAGCAGCTGG - Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944393724 2:199246326-199246348 ATGAAGTTACTGAGAGCAGAAGG - Intergenic
945448586 2:209967270-209967292 CTGATGTGTGGGAGAGCAGAGGG + Intronic
945514918 2:210751341-210751363 CAGATATTCTGCAGAGCAGAAGG + Intergenic
946613366 2:221482663-221482685 ATCAAGTTCAGGGGAGCAGATGG + Exonic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947081104 2:226398093-226398115 CTGAAGTTCTAGAGTCCAGCCGG + Intergenic
947446729 2:230169850-230169872 CCGTAGTCCTGGAGAACAGAGGG - Intronic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
1169312973 20:4562979-4563001 CTGGAGATCAAGAGAGCAGAAGG - Intergenic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1171432346 20:25091025-25091047 CTGAAGTCCTGGGGGGCAGAGGG + Intergenic
1171776510 20:29373174-29373196 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171817785 20:29803680-29803702 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1171900452 20:30851591-30851613 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1172292740 20:33788074-33788096 CAGAAGGTCTGAACAGCAGAGGG - Intronic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1175772352 20:61631800-61631822 CTGAAGGTGTGGACAGCAGTGGG + Intronic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1177361822 21:20083055-20083077 CTTAAGTTCTTCAGAGCAGGGGG - Intergenic
1177489156 21:21799779-21799801 CTGAAGTATTGCAGAGAAGAGGG + Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1178257466 21:31067510-31067532 CTGAGATCCTGGAGAGCTGATGG - Intergenic
1180321233 22:11323169-11323191 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1180333810 22:11557576-11557598 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
1182783695 22:32888866-32888888 CTGAAATGCTTGAGACCAGAAGG - Intronic
1183830204 22:40414764-40414786 ATGAAGTTCTGGAGCGGATAGGG + Intronic
1185021285 22:48377748-48377770 CTGAAGTGCTTGGGACCAGAAGG + Intergenic
1185404808 22:50641733-50641755 CTGACCTTGTGGAGAGCAGGAGG + Intergenic
949159339 3:861024-861046 CTGAAGACCTGGGGAGCAGCGGG - Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950040380 3:9916056-9916078 CTGGAGTTCTGGAGAGGAAGTGG - Exonic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950750173 3:15122181-15122203 TTGCAGTTCTGGACACCAGATGG - Intergenic
953199223 3:40763319-40763341 TTGAACTTATGGAGAGTAGAAGG + Intergenic
956250021 3:67226112-67226134 CTAAAGTGCTAGAGAGCTGATGG - Intergenic
956455050 3:69412433-69412455 CTAAAGTTAGTGAGAGCAGAGGG + Intronic
957088576 3:75706479-75706501 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
959146149 3:102547458-102547480 TTGAAATACTGGACAGCAGAGGG - Intergenic
960091023 3:113638027-113638049 CAGAATTCCTGGTGAGCAGAGGG - Intergenic
960142827 3:114167354-114167376 AGGAAGCTCTGGAGTGCAGACGG + Intronic
960428966 3:117545490-117545512 CAGAAGTCCTGGAGAGAGGAAGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961034599 3:123633778-123633800 CAGAAGGTTAGGAGAGCAGAGGG + Intronic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
962508215 3:136070607-136070629 TTGAAATTCTGGATAGCAGATGG - Intronic
962737496 3:138338924-138338946 CTCAAGGCCTGGGGAGCAGATGG - Intergenic
962843276 3:139254195-139254217 ATGAAGTTCTGGAGCTCACAGGG - Intronic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
965900776 3:173639030-173639052 CTGAAGGACTGGTGAGCATAGGG + Intronic
967275421 3:187769419-187769441 CAGAAGTTTGGGAGAGGAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968049428 3:195644030-195644052 CTGAAGACCTGGAGAGGAGGTGG + Intergenic
968097975 3:195945596-195945618 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968106441 3:196004979-196005001 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968305190 3:197645902-197645924 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968357315 3:198119602-198119624 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
968933268 4:3595609-3595631 CAGAAGTTAGGGAGAGCACAGGG + Intergenic
970138335 4:12951121-12951143 TTGAAGTTCTGGAGGCCAGAAGG + Intergenic
971423879 4:26497817-26497839 CTGAAGTGCTGGAGTGCAGTGGG + Intergenic
972184229 4:36508876-36508898 CAGAATTGCTGGAAAGCAGAAGG - Intergenic
975008711 4:69322452-69322474 CTGAAGTGCAGGGGAGGAGAAGG - Intronic
975029150 4:69592193-69592215 CTGAGATTCAGGAGAGGAGAAGG - Intronic
975225658 4:71868659-71868681 TTGCAGTTGTGGAAAGCAGAAGG + Intergenic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975495812 4:75034968-75034990 CTGAAGTTCAGGACTTCAGAGGG - Intronic
975926487 4:79460901-79460923 CTAAATTTGTGGTGAGCAGAAGG + Intergenic
978268514 4:106858758-106858780 CTGAAGTTCTGGAAGGCAGCTGG - Intergenic
980332380 4:131426453-131426475 CTGGAGCTCTGGAGAGCTCAAGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981432340 4:144676184-144676206 CTGAATTTCTTGGAAGCAGATGG - Intronic
981830988 4:149001666-149001688 CTGGAGTTCTGGAGTTCAGGGGG - Intergenic
983775056 4:171595847-171595869 CTGAAGGTTTGGATAGTAGAAGG - Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
985442071 4:189989244-189989266 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
986630406 5:9767047-9767069 CTGAAGCTCTGGAGAGGCCATGG - Intergenic
986691108 5:10314669-10314691 GTGAAGCTTTGGAGACCAGAAGG + Intergenic
987569498 5:19638009-19638031 CAGAAGTTGTGAAGAGAAGATGG - Intronic
990057997 5:51609843-51609865 GTGAAGTTCAGGAAAGTAGAAGG - Intergenic
990092454 5:52070124-52070146 CAGAAGTTGAGGAGAGTAGAAGG + Intronic
990417121 5:55597213-55597235 CAGGAGTCCTGGAGAGGAGAGGG + Intergenic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
992108244 5:73468376-73468398 CTGAAGACCTGGAGTGCTGATGG + Intergenic
992488523 5:77218537-77218559 CTGCAGTTATTTAGAGCAGAAGG + Intronic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
993383300 5:87232928-87232950 ATGTAGTTCTGGAAAGCTGATGG + Intergenic
993800228 5:92324294-92324316 CTGATGATCTGGAGAACACAAGG - Intergenic
994607360 5:101985863-101985885 CGGAAGTACTGGAGAGTAGTTGG - Intergenic
994972756 5:106762273-106762295 TTGAACTCCTGGAAAGCAGAAGG - Intergenic
995840033 5:116435403-116435425 CTGAATTTCAGAAGAGCACAGGG + Intergenic
996726140 5:126674756-126674778 TTTAAGTTCTTGAGAGAAGAAGG + Intergenic
998523931 5:142825427-142825449 CTGAGGTTATGGAGATGAGAAGG + Intronic
998524446 5:142829516-142829538 CTAGAGATCTGCAGAGCAGAGGG + Intronic
999305332 5:150515816-150515838 CGGGAGTTCTGGAGTGCAGGCGG + Intronic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1000158479 5:158575546-158575568 CTGAAGCTTTGGAGAGCTGATGG + Intergenic
1000291358 5:159874381-159874403 CTGAAGCTCTGTAGAGCTGTGGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002565329 5:180109919-180109941 ATACACTTCTGGAGAGCAGAGGG - Intronic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003175361 6:3750030-3750052 GTGAGGCTCTGGGGAGCAGAGGG + Intronic
1003541249 6:7019939-7019961 ATGAAGATCTGGAGACCAGCTGG - Intergenic
1003848170 6:10195543-10195565 CTGCAGTTTTGGTGAACAGAAGG - Intronic
1003996324 6:11544366-11544388 CTGAAATGCTTGAGACCAGAAGG - Intronic
1004289593 6:14354006-14354028 ATGAAGTGCTGGAGATGAGAAGG - Intergenic
1004383016 6:15148749-15148771 CAGACATTCTGGAGAACAGAAGG - Intergenic
1004634390 6:17453117-17453139 CTCAAGATCTGCTGAGCAGATGG - Intronic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1007855234 6:44848729-44848751 CTGTAATTCTGGAAAGCAGGGGG + Intronic
1007996031 6:46308900-46308922 CTTAAATACTGGAGAGGAGATGG + Intronic
1008457668 6:51729477-51729499 CTGAAGATCAAGATAGCAGAGGG + Intronic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1010908205 6:81519595-81519617 CTGAACAGCTGGAAAGCAGATGG - Intronic
1010921232 6:81683254-81683276 TTTAAGTTCCAGAGAGCAGATGG + Intronic
1013443332 6:110193715-110193737 CTGAACTTTTGGAGAATAGAAGG - Intronic
1014510518 6:122315923-122315945 TTAAAGTTCTGTAGATCAGAAGG - Intergenic
1014657578 6:124127609-124127631 CTGATGGTTTGGTGAGCAGAGGG + Intronic
1014947753 6:127516741-127516763 CTGAATTTTTGCAGAGCAAAGGG + Intronic
1016345383 6:143107624-143107646 CTAAAGGTCTGGGAAGCAGAGGG + Intronic
1016933639 6:149432376-149432398 CTTAACTTCTGGAAGGCAGAGGG - Intergenic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1020377565 7:7505188-7505210 CTGAAGTTGTAGGGAGCAGTTGG - Intronic
1020723736 7:11782172-11782194 ATGAAGTGCTGCAGAACAGATGG - Intronic
1020880316 7:13753849-13753871 CTGAAGTTCAGGTGAGGAGTGGG - Intergenic
1021656799 7:22881127-22881149 CTGAAGTGCTGAAGCACAGAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1027411123 7:77918890-77918912 CTGGAGCTCTGTAGAGCATATGG + Intronic
1028979791 7:96954670-96954692 CTGCAGTTCTTGAGTGCATAGGG - Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029419358 7:100464511-100464533 CTGAAATTCAGGAAAGCTGAAGG + Intronic
1029811995 7:103058525-103058547 CAGAAGTGCTAGAGAGCAGATGG - Intronic
1030108864 7:106009553-106009575 GTGGAGTTCTTGAGAGCAGGTGG + Intronic
1031362283 7:120860887-120860909 CTAAAGTTGTGGAGAGAAAAAGG + Intergenic
1032156234 7:129470705-129470727 CTGAAAGTCTGGTAAGCAGATGG + Exonic
1034703099 7:153113854-153113876 CTGAAAATCTGGGGAGCAAAGGG - Intergenic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1034904323 7:154930514-154930536 CCCAAGTCCTGGAAAGCAGAGGG + Intronic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1036201869 8:6776791-6776813 CCACAGTTCTGGAGAGTAGAAGG - Intergenic
1036471025 8:9052940-9052962 CTCAACCTCTGGAGAGAAGAGGG + Intronic
1037606488 8:20442090-20442112 CTGGAGTTCAGGGGAGGAGAAGG + Intergenic
1039407332 8:37324846-37324868 CTGAGGTTCAGGGAAGCAGAAGG + Intergenic
1039730442 8:40269927-40269949 CTGCATTTCTGAAGACCAGATGG - Intergenic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1041192862 8:55370959-55370981 CTGAAATTTTGGAGAGCAGGGGG - Intronic
1042491722 8:69407171-69407193 CTGATCTTCTGTAGAGCAAAGGG + Intergenic
1047768842 8:128014031-128014053 CTGTTGTTCTGGTGAGCAGTGGG + Intergenic
1048163121 8:132038940-132038962 CTGAGGATCTGGACAGCAGCTGG - Intronic
1048465316 8:134660724-134660746 CTGAACTTCTGGGGACCACAGGG + Intronic
1050032452 9:1400863-1400885 CTGAAGTTTTGGAGAGGAAGAGG - Intergenic
1051133153 9:13885509-13885531 CTGAAATTTTGGAGACCAGAAGG + Intergenic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052076375 9:24145690-24145712 CTGAATTTCAGAAGAGCAGCAGG - Intergenic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053351171 9:37414346-37414368 CTGCTCTTCTGGGGAGCAGAGGG - Intergenic
1054456867 9:65436200-65436222 CAGAAGTTAGGGAGAGCACAGGG - Intergenic
1054821947 9:69531534-69531556 CTGGAGTGCTGGAGAGGGGAAGG - Intronic
1055394105 9:75855124-75855146 CTGCAATTCTGGAGAAAAGAGGG + Intergenic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1057020996 9:91697574-91697596 CAGAGGTTCTGGGGAGCATAGGG - Intronic
1057395971 9:94680735-94680757 CTGAGGTTCTGGGAAGCACATGG - Intergenic
1057397892 9:94696317-94696339 CTTATGTTCTGGTGAGCAGAGGG - Intergenic
1058651166 9:107176864-107176886 ATACAGTTCTGGAGAGCAGAAGG - Intergenic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1059947127 9:119421016-119421038 GTGAATTTCTTGAGAGCAGGGGG - Intergenic
1060251634 9:121990942-121990964 CTGCAGCTATGGAGAGCGGATGG + Intronic
1060803398 9:126558654-126558676 CTGAGGTCCTGGTCAGCAGAGGG - Intergenic
1061319595 9:129819880-129819902 CTGGAGTGCTGGAGTGCAGTGGG - Intronic
1061417667 9:130455943-130455965 CCCGAGTGCTGGAGAGCAGAGGG + Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1203369445 Un_KI270442v1:288942-288964 CTGAAGTGGTGGAGAGCACAAGG + Intergenic
1186613670 X:11164059-11164081 CTGATGTTCAGGCCAGCAGATGG - Intronic
1187572974 X:20523905-20523927 TTGAAGCCCTGGAGAACAGAGGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1191923385 X:66281063-66281085 CTGAAGTTCTAGAGGCTAGAGGG + Intergenic
1192093183 X:68182603-68182625 CTGAAGTTGTTGAAAACAGAGGG + Intronic
1192561280 X:72129731-72129753 CTGAAGTCCTGGTCAGCAAATGG + Exonic
1192622133 X:72688563-72688585 TTCAAGATCTGGAGAGAAGAAGG - Intronic
1192908611 X:75579247-75579269 CTGAAGTTATGGAGGGGTGATGG + Intergenic
1193593958 X:83423054-83423076 CTGAAGTTGTGCAGGGCAGTGGG - Intergenic
1194647305 X:96473138-96473160 CTGAAGCTTTGCAGTGCAGATGG - Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1197747918 X:129945323-129945345 CTCAAGTTCTGAAGTCCAGAGGG - Intergenic
1198322780 X:135535686-135535708 CCAAACTTATGGAGAGCAGATGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198756164 X:139984853-139984875 CAGAAAGTCTGGAAAGCAGAAGG - Intergenic
1199196088 X:145032633-145032655 CTGAGGTTGTGCAGAGCAGTAGG - Intergenic
1201068834 Y:10126018-10126040 CTGAAGTGGTGGAGAGCACAAGG - Intergenic
1201378112 Y:13343734-13343756 CTGAAGTTCCGACCAGCAGAGGG - Intronic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic