ID: 918046088

View in Genome Browser
Species Human (GRCh38)
Location 1:180941845-180941867
Sequence TGTTAAAAGAAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 698}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918046088_918046091 -10 Left 918046088 1:180941845-180941867 CCCTCCTCATTCTTCTTTTAACA 0: 1
1: 1
2: 3
3: 57
4: 698
Right 918046091 1:180941858-180941880 TCTTTTAACACGCTTGACCCCGG 0: 1
1: 0
2: 0
3: 8
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918046088 Original CRISPR TGTTAAAAGAAGAATGAGGA GGG (reversed) Intronic
900716282 1:4147037-4147059 TTTTAAAAGAAGAATCATGTTGG - Intergenic
902524240 1:17044625-17044647 TTTTAAAACAAGAATGAGCTTGG - Intronic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
903046018 1:20564718-20564740 TATTCAAAGAAGAATGAGCTGGG - Intergenic
903207695 1:21795237-21795259 TGATAAGCGAAGGATGAGGAGGG + Intergenic
903852649 1:26317521-26317543 TGTTTAAAGAAGATTGGGGCAGG - Intronic
904078517 1:27857620-27857642 TGTTTCAAGAAGACTGAAGACGG + Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904346453 1:29874760-29874782 TGTTAAAAAAAGAATAAAGTGGG + Intergenic
904395455 1:30218270-30218292 TTTTAAAAGAAAAATGGGGAGGG - Intergenic
905027623 1:34861715-34861737 TCAGAAAAGAAGACTGAGGAAGG - Intergenic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
905412390 1:37779541-37779563 TGTTAAAAGAAAGAAAAGGAAGG + Intergenic
905485192 1:38291162-38291184 TGTTAAAAAAAGAAAAAGGAAGG - Intergenic
906562282 1:46768005-46768027 CGATAAAAGAAGAATGAGTGAGG - Intronic
906895988 1:49773016-49773038 TGATTAAAAAAGAATGAAGAAGG - Intronic
907908649 1:58808247-58808269 TTTTGACAGATGAATGAGGAGGG + Intergenic
908317399 1:62946654-62946676 TGTTGAAAGAAGGGTGAAGAAGG + Intergenic
908478112 1:64508741-64508763 TCTTAACAGAAGACTGAGTATGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
909816988 1:80006813-80006835 GGCTGAAAGAAAAATGAGGAGGG - Intergenic
910449331 1:87330264-87330286 TTTTAAAAGGAGAGTGAGGGAGG - Intronic
910828692 1:91437267-91437289 TGGTATAAGAAGAATGGGTAGGG - Intergenic
910917216 1:92302303-92302325 GGAAAAAAGAAAAATGAGGATGG + Intronic
910990265 1:93048809-93048831 TGTGAAAATAATAATGAGGCTGG + Intergenic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
911472924 1:98340341-98340363 TGTTACCAGAAGAATGGAGAAGG + Intergenic
911482968 1:98467522-98467544 CATTAATAGAAGAATGAGAAAGG + Intergenic
911730712 1:101289563-101289585 TGTTAATAAAAGAAAGAGGTGGG - Intergenic
912044079 1:105432932-105432954 TGTAAAATGAAGAATGACTATGG - Intergenic
912494970 1:110085699-110085721 TGTTAGAAAAAGAGAGAGGACGG + Intergenic
914666235 1:149835206-149835228 TCTCAAAAAAAGAAAGAGGAAGG - Intergenic
914669532 1:149858592-149858614 TCTCAAAAAAAGAAAGAGGAAGG + Intronic
914679981 1:149932202-149932224 AGTTAACAGAAGGTTGAGGAAGG + Intronic
915233914 1:154466373-154466395 TGTGAAAAGAAAAATGAGCCTGG + Exonic
915322984 1:155066166-155066188 CGGTAAAAAAAGAATGAGGGAGG - Intronic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
915878008 1:159633441-159633463 TTTTAAAGGAAGAATGAGAAGGG - Intergenic
916165464 1:161963301-161963323 TATGAAAAGAAGAATGACAAAGG + Exonic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916955952 1:169835013-169835035 TGTTACAGGATGAATGTGGAAGG + Intronic
917112444 1:171562589-171562611 TGTTAAATGGAGTATGAGAAGGG + Intronic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917282409 1:173391044-173391066 TCATAAAAGAAGAATGTTGAAGG - Intergenic
917801769 1:178577862-178577884 TGTTATAATAAAAGTGAGGATGG + Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918056450 1:181025647-181025669 TGATGAAAGAAGAGGGAGGAAGG + Intergenic
918642265 1:186857188-186857210 TGTTAAAAGAAGAAACTGAATGG + Intronic
918739462 1:188108640-188108662 TGAAACAAGAAGACTGAGGATGG - Intergenic
919138046 1:193535337-193535359 TGATAGAGGAAGAATGGGGATGG - Intergenic
919272946 1:195374358-195374380 TGAAAAAAGAAGAAACAGGAAGG + Intergenic
919666794 1:200300265-200300287 TGTTAAATAAAGCATAAGGAAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920992177 1:210950081-210950103 TGTTCAGAGAAGAATGAAGGTGG - Intronic
921444851 1:215233612-215233634 TTTTAAAAGAAAAATCAAGAGGG + Intronic
921562219 1:216672578-216672600 TGTTAAAATAAGAAGTAAGATGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922594164 1:226800921-226800943 TTTTGAAAGATGAATGAGAATGG - Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
923729768 1:236538986-236539008 TGATAAATGAAAAATGGGGACGG + Exonic
923903479 1:238355766-238355788 TTTTAAAAGAATAATTAGGCCGG + Intergenic
1063666635 10:8064856-8064878 TTTTAAAAGAATAATGAGAGAGG - Intronic
1063673373 10:8117842-8117864 TGTTAAAAAAAAAAAGCGGAGGG + Intergenic
1063700037 10:8375598-8375620 TGTTAACAGGTGAATGGGGATGG - Intergenic
1064061859 10:12144747-12144769 TGTTCAAAGATCATTGAGGAGGG + Intronic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064749352 10:18510597-18510619 TTTTAAAATAAGAGTGAGGCTGG - Intronic
1064919542 10:20501772-20501794 TGTTACTAGAAGAAAGACGATGG - Intergenic
1064976167 10:21118244-21118266 TGTTGAAAGAACGATAAGGAAGG - Intronic
1065182728 10:23143214-23143236 AGTTAAAATAAGGAGGAGGATGG + Intergenic
1065571776 10:27078422-27078444 TTTTAAAAGATGAAAGAGTAGGG + Intronic
1065577576 10:27138284-27138306 TGTTAAAAGAATACTAATGAAGG - Intronic
1066310905 10:34195656-34195678 TGTTCCGAGAAGAATGAGAAGGG + Intronic
1066322141 10:34314123-34314145 TCTTAAAAGAACAAAGAGAAAGG + Intronic
1066336157 10:34480533-34480555 TGTTAAAAGTAGAAACAGGTTGG - Intronic
1066608918 10:37214221-37214243 TGACAAAAGAAGGCTGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067055607 10:43048187-43048209 TGGTAAAAGAAAAATGAAAACGG - Intergenic
1067397232 10:45933175-45933197 TTTTAAAAGAAGGATGAAAATGG + Intergenic
1067508878 10:46878495-46878517 TGTTTTAGGAAGAATGAGGAGGG + Intergenic
1067653371 10:48173355-48173377 TGTTTTAGGAAGAACGAGGAGGG - Intronic
1067816724 10:49483822-49483844 TGTCAAAACAACAATGTGGATGG + Intronic
1067865554 10:49902276-49902298 TTTTAAAAGAAGGATGAAAATGG + Intronic
1068246567 10:54378621-54378643 CATTTAAAGAAGAATGAGAAAGG - Intronic
1068362525 10:55996363-55996385 TAATAAAAGAAGAAAGAGAAAGG - Intergenic
1068687590 10:59885214-59885236 TATTGAAAAAAGAATGAAGATGG - Intronic
1068791200 10:61033360-61033382 TGTCAAAAGACAAATGAAGAAGG - Intergenic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1070076509 10:73141593-73141615 TGTTAAAAAAAGAAAGATAATGG - Intronic
1070191731 10:74117648-74117670 TCTCAAAAAAAGAATGAGCAGGG + Intronic
1070352152 10:75602934-75602956 GGGAAAAAGAAGTATGAGGAGGG - Intronic
1070607537 10:77909500-77909522 TATTAAAAAAAAAATGAGGGTGG + Intronic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1071885432 10:89944564-89944586 TGTTAAAAAAAGATTGGGGATGG + Intergenic
1071930192 10:90460922-90460944 AGAACAAAGAAGAATGAGGAAGG + Intergenic
1072268572 10:93753853-93753875 TGTTGAAAGCAGAGTGAGAAAGG - Intergenic
1072277376 10:93836338-93836360 TGTTGAAAGAAAAAAGAAGAAGG - Intergenic
1072367186 10:94724258-94724280 GGTTACAAGAAGCATAAGGAAGG - Intronic
1073308730 10:102524149-102524171 TTTAAAAAGAAGAATTAGGCAGG - Intronic
1073580898 10:104664751-104664773 TATTCAAATATGAATGAGGAAGG + Intronic
1073682208 10:105716793-105716815 TGTAAAAGAAAGAAAGAGGAAGG - Intergenic
1073848899 10:107591654-107591676 TGTAAAAAGAAAAATATGGATGG + Intergenic
1074641136 10:115382137-115382159 TTTTAAAAGAAGAATAAAGTTGG - Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074771153 10:116735086-116735108 TGATAAATGAAGAATGATGGTGG - Intronic
1075198623 10:120382782-120382804 TGTTAGAAGGTGAATGAGGTGGG - Intergenic
1076069191 10:127472629-127472651 GGCTAAAAGAAGAATCAGCATGG - Intergenic
1076443513 10:130496282-130496304 TGATCAAAGGAGGATGAGGATGG + Intergenic
1077260013 11:1612304-1612326 TTTAAAAAGAAGAATGAAGTTGG - Intergenic
1078652794 11:13211502-13211524 TATTAAAAAAAGAATGATGGAGG + Intergenic
1080023288 11:27586938-27586960 TGGTAAAAAAAGAATGAAGAAGG - Intergenic
1080123593 11:28705227-28705249 TATAGAAAGAAGAATGAAGAGGG + Intergenic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1080760096 11:35240364-35240386 GGTTAAAGGAAGAAAGATGAGGG + Intergenic
1080846222 11:36029364-36029386 TGTTAAAGGGAGCAGGAGGAGGG + Intronic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081837557 11:46168905-46168927 TTTTAAAAGTTTAATGAGGAGGG + Intergenic
1082960433 11:58914181-58914203 TGTTAAAAGCAGAAACAGCATGG - Intronic
1082980373 11:59115338-59115360 TGTTAAAAGCAGAAACAGCATGG - Intronic
1084929830 11:72546142-72546164 TGTGAACAGAAAGATGAGGAAGG - Intergenic
1084932659 11:72569531-72569553 TTTTAAAACAAAAATGAGGCTGG + Intergenic
1085773867 11:79348164-79348186 TGTTAAAAGACTAATGACTATGG - Intronic
1085792768 11:79510308-79510330 TGTTAAATGAATGATGAGCAAGG + Intergenic
1085857726 11:80194883-80194905 TGATAAAAGAAAAATGGGAAAGG + Intergenic
1086849778 11:91795977-91795999 TGTTTAAAAAAGAATATGGAGGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087384850 11:97457828-97457850 TGTTAGATGAAGAATGAGAGCGG + Intergenic
1087627901 11:100617956-100617978 GGGTAAAAGAAGAATCAGTATGG - Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087955736 11:104285625-104285647 GGTTAAAAGAAGCAATAGGAAGG - Intergenic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089847443 11:121469401-121469423 CGATAAAATAAAAATGAGGAAGG - Intronic
1089847957 11:121473171-121473193 TCTTTAAAGAAGACTGAGCATGG + Intronic
1090065778 11:123502265-123502287 TGATGAAAGAAGAGTTAGGATGG - Intergenic
1090080418 11:123608880-123608902 TGTGGAAAGAAGAATAAGGAAGG - Intronic
1092067425 12:5603493-5603515 TGGTAGAAGAAGAAAGAGAAAGG + Intronic
1092629911 12:10365980-10366002 TGTCAAAAGAATAAGGAGAATGG + Intergenic
1092815678 12:12310517-12310539 TGTTAACAGAAGAAAGGGGAAGG + Intergenic
1093080163 12:14801820-14801842 TTGTAAAAGAAGAATAAGAAGGG + Intronic
1093341202 12:17976138-17976160 TGGTAAAAGAAAAGTGATGATGG - Intergenic
1093343821 12:18014847-18014869 TTTTAAAAGAAGAATAAAGTGGG - Intergenic
1093798138 12:23338043-23338065 TGAGAAAAGAAAAATAAGGATGG + Intergenic
1094175201 12:27534135-27534157 TATTAAAAGAAGAAAAAGGGAGG + Intronic
1094243796 12:28262406-28262428 TGTTAAGTAAAGAATGAGGTGGG + Intronic
1094799740 12:34019269-34019291 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095112529 12:38313588-38313610 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095383374 12:41620981-41621003 TGTTCACTGAAGAATGGGGAAGG - Intergenic
1095550990 12:43439349-43439371 TGTGAAAAAGAGAATGAGAACGG + Intronic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1096007644 12:48185230-48185252 TGGTAAAGGAAGCTTGAGGAGGG + Exonic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1097113058 12:56676532-56676554 TGTTAAAAGAAGAATGCTTCAGG + Intronic
1097350356 12:58542298-58542320 GGTTAAAAGAAGATTAGGGAAGG + Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097604777 12:61740132-61740154 TGTTAAAAGAAAACTGGTGAGGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098042188 12:66363549-66363571 TGTTTAAAGAGGCATAAGGAGGG - Intronic
1098390798 12:69967867-69967889 TGAAGAAAGAAGAATGAGGCAGG - Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1099726575 12:86437447-86437469 TATTAAAAAGAAAATGAGGAAGG + Intronic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1100451696 12:94712722-94712744 TATTAATAAAAGAAAGAGGAGGG - Intergenic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101403621 12:104409689-104409711 TGTTAGCAGAAAAAGGAGGAAGG - Intergenic
1101495904 12:105253959-105253981 TGTTACCAGAAGAAGGGGGATGG + Intronic
1101813330 12:108126703-108126725 TGTGAAAGGGAGAATGAGGTTGG - Intergenic
1102762522 12:115400788-115400810 TGTTAAAAGCTGGATGAGGCTGG + Intergenic
1103033531 12:117637791-117637813 TGTAAAAATAAGACTGAGGCAGG - Intronic
1103057916 12:117836102-117836124 TGTTAAAAGAAGATTGCGATTGG + Intronic
1103109331 12:118261445-118261467 TGTTAAATACAGAATCAGGAAGG + Intronic
1104011908 12:124937162-124937184 TTTTAAAAGAAAAATTAGGTTGG - Intergenic
1104161220 12:126182617-126182639 TTTTAAAAGCAGAATAAGGCTGG - Intergenic
1104832559 12:131763828-131763850 TTTTTAAAGAAAAATGAGGCCGG + Intronic
1105876211 13:24555567-24555589 TGTTAAAAGAAAAACTAGGGGGG - Intergenic
1106621377 13:31374196-31374218 TGGGAAAAGAAGCAGGAGGAGGG - Intergenic
1107246695 13:38305323-38305345 AGTTTAAAGAAGAAAGAGGCTGG - Intergenic
1107520614 13:41176981-41177003 TGTCAAGAGAACAATAAGGAAGG - Intergenic
1107571366 13:41662079-41662101 TTTTAAAAGAAGAATAAAGTTGG - Intronic
1107580643 13:41780490-41780512 TGATAAGAGAGGAATAAGGAGGG - Intronic
1108366211 13:49716736-49716758 TTTTAAAAGTAGTATGATGATGG - Intronic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1109128362 13:58547470-58547492 TGAAAAAGCAAGAATGAGGATGG - Intergenic
1109217455 13:59605758-59605780 GGAAGAAAGAAGAATGAGGAAGG + Intergenic
1109217457 13:59605772-59605794 TGAGGAAGGAAGAATGAGGACGG + Intergenic
1109269125 13:60234780-60234802 TTTTAAAGGTAAAATGAGGAGGG - Intergenic
1109543745 13:63814359-63814381 TGATAACTGAAGGATGAGGAGGG + Intergenic
1109902984 13:68797858-68797880 TGGTAGAAGAGGAATCAGGAAGG - Intergenic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1110782190 13:79479731-79479753 TTTAAAAAGAACTATGAGGAAGG + Intergenic
1110927167 13:81168320-81168342 TGTTAAAAAAAAAAGAAGGAAGG - Intergenic
1111684921 13:91489952-91489974 TATTAAAAGAAAAAGGCGGAGGG + Intronic
1112216563 13:97436265-97436287 TGTTAAACTTAGTATGAGGATGG + Intronic
1112536553 13:100262705-100262727 TGTGAAAAAAAGAAGGAAGAAGG - Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113562276 13:111291316-111291338 TGTTAAAAGGAGAATGACAGAGG - Intronic
1113628124 13:111861541-111861563 GGTTAAAAGAAGGATGAGGGAGG + Intergenic
1115307431 14:31946907-31946929 TGTTAAAATAAGATTTTGGAGGG - Intronic
1116204895 14:41852131-41852153 TCTTAAAAGAAGACTGAAAATGG - Intronic
1116655755 14:47651625-47651647 AGTTATATGAAGCATGAGGAAGG + Intronic
1117386767 14:55222452-55222474 TTTTAAAAGAAGAATAAAGAAGG + Intergenic
1118401083 14:65380208-65380230 TGGCAAGAGAAAAATGAGGAAGG + Intergenic
1119211759 14:72837194-72837216 AGTGCAAAGAAGAATGAGGGTGG + Intronic
1120195242 14:81474966-81474988 TGCTAAAGGAAAAATGAGGGTGG + Exonic
1120778544 14:88464138-88464160 TATTTATAGAAAAATGAGGAAGG - Intronic
1120788998 14:88562461-88562483 TGTTCAGAGAAGCAGGAGGATGG + Intergenic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1122611509 14:102986491-102986513 TGTTTGAAGATGAATGATGATGG - Exonic
1123173355 14:106395429-106395451 GGTTTAAAGAAAAATGAGGAGGG + Intergenic
1123217592 14:106826261-106826283 TTTTAAAGAAAAAATGAGGAGGG + Intergenic
1123796803 15:23780849-23780871 TGTTCAGTGAAGAATGTGGATGG - Intergenic
1123907000 15:24931429-24931451 TTTTAAAGGAAGAATGAAGCTGG + Intronic
1124049342 15:26180439-26180461 TGATAAAGGAAGAAGGATGAGGG + Intergenic
1124087773 15:26567887-26567909 TATTTATAGAAGAATTAGGAGGG + Intronic
1124424210 15:29549564-29549586 TGCTAAAAGATGAATGAAGCCGG - Intronic
1124666468 15:31597469-31597491 TGTTAAAAAAAAAAAAAGGAGGG - Intronic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1125359304 15:38848909-38848931 TGAAGAAAGAAAAATGAGGATGG + Intergenic
1125646485 15:41276979-41277001 TGAGGTAAGAAGAATGAGGAAGG + Intronic
1125860587 15:42995814-42995836 TGTTATAAAATGAAGGAGGAGGG + Intronic
1126167295 15:45664499-45664521 TGTTTAAAGCAGAATAAAGAGGG - Intronic
1126739169 15:51760431-51760453 TCTTAAAAGATGGAAGAGGAAGG - Intronic
1127124404 15:55798114-55798136 AGTTAAAATAAGAAAGAGAAAGG + Intergenic
1127353711 15:58177587-58177609 TGTAAGCAGAAGAATCAGGATGG - Intronic
1127489334 15:59447677-59447699 TGGTAAAAGAAGGAGGAAGAGGG - Intronic
1127622973 15:60752086-60752108 TGCTAAAAAAAAAATGGGGAGGG + Intronic
1127870294 15:63067413-63067435 AATTTAAAAAAGAATGAGGAAGG - Intronic
1127975539 15:63994400-63994422 TGTTAAAAGAAAAGGAAGGAAGG + Intronic
1128043552 15:64596609-64596631 TGATAAGAGAACAATGAGAAGGG - Intronic
1128459739 15:67857851-67857873 TTTTAAAATAAGAAAGAAGATGG - Intergenic
1129091725 15:73157897-73157919 TTTTAAAAGAACAATGAGAAGGG - Intronic
1130353545 15:83110841-83110863 TTTTTAAAAAAGAATGAGGGTGG - Intronic
1131238932 15:90721617-90721639 TTTTAAAAGAAAAATTAGGCTGG - Intronic
1132135266 15:99331423-99331445 TTTTAACAGAAGCATGAGGTAGG - Intronic
1134170658 16:11966499-11966521 TGTCAAAATCAGAATGAAGATGG - Intronic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1134903646 16:17960812-17960834 TGTCAAAAGAAGAATAATGCTGG - Intergenic
1135341773 16:21654339-21654361 TGTTAAAACCAGATTGAGGCCGG - Intronic
1135749288 16:25044141-25044163 TTTTACAAGGAGAATGAGAAAGG + Intergenic
1137022497 16:35442477-35442499 GGTTAAAAGATGAAAGATGAGGG + Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137526889 16:49244373-49244395 AGCAAAGAGAAGAATGAGGATGG + Intergenic
1137715114 16:50593903-50593925 TGTTCCCAGAAGAAGGAGGAAGG + Intronic
1137816179 16:51400018-51400040 TGTTGCAGGAAGAATTAGGATGG + Intergenic
1138962066 16:62038888-62038910 TGCAAAAAGTAGAATGAGGCAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1141192596 16:81835293-81835315 TGTTATAATAATAATGAAGATGG + Intronic
1141218578 16:82047768-82047790 AGTCAAAAGAAGAATCAGAAAGG - Intronic
1141493666 16:84391908-84391930 TTTTAAAAAAAAAAAGAGGAAGG - Intronic
1142436949 16:90065933-90065955 AGTTCTAAGAAGAATCAGGAAGG + Intronic
1142441187 16:90098500-90098522 TGTGAAGAGAAGACTGATGAGGG - Intergenic
1142809920 17:2390902-2390924 TGTTAAAGCCAGAATGAGGGAGG - Intronic
1144367357 17:14557234-14557256 TGTCAAAAGAAAAATGTGGCCGG + Intergenic
1144914884 17:18716357-18716379 TGAGAAAAGAACCATGAGGAGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146091045 17:29878129-29878151 TTTTAAAAGAACAAAGAGGCCGG + Intronic
1146453374 17:32991828-32991850 TGTTAAGAGAACAATGGGGAAGG - Intronic
1146479251 17:33191515-33191537 TGTTAAAAGAAGAAGAAGAAGGG + Intronic
1146801498 17:35827402-35827424 TATTAAAAGAAGAAGGGGCATGG + Intronic
1150585747 17:66516334-66516356 TGTGAAAAAAAGAATAAGGCTGG + Intronic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151024633 17:70663397-70663419 TGTTAAAAGAATGATTAGGCTGG + Intergenic
1151092519 17:71459216-71459238 TGTTCAAAGTCTAATGAGGAAGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152152014 17:78607590-78607612 TGTTAAAATAAAAATGTGGCCGG + Intergenic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153495869 18:5698978-5699000 TTTTAAAAGAAGACAGAGAAAGG - Intergenic
1153604098 18:6814104-6814126 TGAAAGAAGAAGAATAAGGAAGG + Intronic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1155031040 18:21984118-21984140 TGTTTAAACAAGAATTAGGCTGG + Intergenic
1155302531 18:24443810-24443832 TGCTGAAAGGAGAATGAGAAAGG - Intronic
1155631658 18:27901308-27901330 TGTTCACAGAAGAATGCGAATGG - Intergenic
1155778375 18:29797276-29797298 TGTGAAAAGAACAATGAATATGG + Intergenic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156956849 18:42976950-42976972 TGAGAAAACAAGAAGGAGGAAGG + Intronic
1157299381 18:46468589-46468611 TGTTGCAAGATGAAAGAGGATGG + Intergenic
1157461515 18:47900496-47900518 TGATAAAAGGAGGATGGGGAGGG - Intronic
1157541300 18:48512113-48512135 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157541543 18:48514423-48514445 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157785572 18:50479049-50479071 TTTTAAAGGTAAAATGAGGAAGG + Intergenic
1157791831 18:50538972-50538994 AGTTAAAACCAAAATGAGGATGG - Intergenic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158550748 18:58433731-58433753 TGTTAAAAAAAAAATCAGGCCGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1161092571 19:2369342-2369364 TGTGAAGAGGAGACTGAGGAGGG + Intergenic
1162214669 19:9123601-9123623 TTTTAATGGAAAAATGAGGAAGG + Intergenic
1162253779 19:9470568-9470590 TGTTGGCTGAAGAATGAGGAAGG + Intronic
1162280576 19:9693870-9693892 TGTTCACTGGAGAATGAGGAAGG + Intronic
1162627956 19:11900772-11900794 TGTTAAAAGAAGAAAAAGAGAGG - Intronic
1163284263 19:16336608-16336630 TGTTTAAAGAAAAAGGAGGGGGG - Intergenic
1164518404 19:28956625-28956647 TGGTTAAAGGATAATGAGGAAGG + Intergenic
1165086613 19:33352854-33352876 TGTTTAGAAAAGAATGATGAGGG - Intergenic
1166466393 19:43035561-43035583 TGTTAAAAAAAGGATCAAGAGGG + Intronic
1166493304 19:43278621-43278643 TGTTAAAAAAAGGATCAAGAGGG + Intergenic
1166991537 19:46695719-46695741 TGTCAAAAGAGGAAGGAGGGAGG + Intronic
1167789365 19:51663512-51663534 GGAGAAAAGAAGAATGAGGCCGG - Intergenic
1167913873 19:52724993-52725015 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167921379 19:52785997-52786019 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167934204 19:52893073-52893095 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167940384 19:52941910-52941932 AGAGAAAAGAAGAATGAGAAAGG - Intronic
1167991791 19:53366458-53366480 AGAGAAAAGAAGAATGAGAAAGG + Intronic
1168555647 19:57337363-57337385 TATTAAAAGAATAATGGGGCCGG - Intergenic
925911631 2:8577552-8577574 TTTTAAAAAAGGAATGAGTAAGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926851127 2:17198515-17198537 TGTTAAAAGATGAATCTAGAAGG - Intergenic
927065961 2:19471373-19471395 TCTTAAAAGAAATATGAAGATGG - Intergenic
927091136 2:19713586-19713608 TGTTCCAGGAAGAAAGAGGAGGG + Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927585731 2:24302509-24302531 TTTTAAAAGAAGGATAATGATGG + Intronic
927601136 2:24442208-24442230 TTTTGAAAGAAGAATGAGACGGG - Intergenic
928791220 2:34956480-34956502 TGTGTAAAGAAGAAAGAGGGAGG - Intergenic
928800982 2:35091450-35091472 TATTAAAAGATAAATGACGATGG + Intergenic
928934615 2:36662621-36662643 TCTTAAAAAAACAAAGAGGAGGG - Intergenic
929017957 2:37519307-37519329 TGTTAAAAGAAGAACAAGGTTGG - Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
931202525 2:60112498-60112520 TGTAAAAATAAGAATGATAATGG + Intergenic
931337949 2:61367920-61367942 AGTTATAACAATAATGAGGAAGG + Intronic
931718894 2:65052904-65052926 TTTTAAAAGATGACTGAGGATGG + Intergenic
932134924 2:69219906-69219928 TGTTCAAAAAAAAATCAGGAAGG - Intronic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
932652833 2:73578501-73578523 TGTTAAAAAAAAAATGAAAAGGG - Intronic
932804287 2:74769487-74769509 GGTTAAAACAAAAATTAGGATGG + Intergenic
932867037 2:75354584-75354606 TGTTAAAACAAGGATCAGGCAGG + Intergenic
933021092 2:77193489-77193511 TGTTAAAAAAAAAAAGAGCAAGG - Intronic
933165951 2:79075051-79075073 TGTTAAAAGATGCATAGGGATGG - Intergenic
933565872 2:83949912-83949934 TCTTTAAAGAAGAATGACAAGGG + Intergenic
933792785 2:85896468-85896490 TGTGAAAATAGGAATTAGGAAGG + Intergenic
934497500 2:94820751-94820773 TAATAAAAAAAGAATGAGGTAGG - Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
934902733 2:98173664-98173686 TGTTAAAAAATGACTGTGGAGGG + Intronic
934944272 2:98526478-98526500 TTTAAAAATAAGAATGATGAGGG + Intronic
934956287 2:98623033-98623055 TGATAAAAAGAGAAAGAGGAGGG + Exonic
934962113 2:98685322-98685344 TTTTTAAATATGAATGAGGAAGG + Intronic
934999140 2:98994602-98994624 AGTTAAAATAAGAAAGAAGATGG + Intergenic
935418188 2:102840600-102840622 AATTAAAACAAAAATGAGGAAGG + Intronic
936474166 2:112825002-112825024 TGGGAAATGAAGAATGAGGTGGG + Intergenic
937102881 2:119285309-119285331 TGTTACAGGAAAAATAAGGAAGG - Intergenic
937118953 2:119428968-119428990 TGTTAAAAGCAGAAACAGCATGG - Intergenic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938663207 2:133508078-133508100 TGTTAATAGAGGAGTCAGGAGGG + Intronic
938885483 2:135643558-135643580 TGTTAAAAAAAGAAACAAGAAGG - Intronic
938990814 2:136627721-136627743 TGTTAAAGGAACTAAGAGGAAGG - Intergenic
939566633 2:143793300-143793322 TTTTAAAAGAAGATTGAGGGCGG - Intergenic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
940227697 2:151417270-151417292 TGTTACAACAAAAATGAAGAAGG - Intronic
940405202 2:153293336-153293358 CCTTAAAAGATGAAAGAGGAAGG + Intergenic
940755964 2:157683821-157683843 TGTTTAAAGAAGAATTTGGATGG + Intergenic
940935695 2:159491909-159491931 AATAAAAAGAAGAATTAGGATGG - Intronic
941196637 2:162460369-162460391 TTTTAAAAAAATATTGAGGATGG + Intronic
941567971 2:167132120-167132142 TCTTAAAGAAAGAATGATGATGG - Intronic
941701977 2:168613354-168613376 TGTGAAAAGAAGGCTGAGGATGG + Intronic
942346725 2:175010823-175010845 AGATAAAAGAAGAATGATGATGG + Intergenic
942618885 2:177826034-177826056 TGTTAAACCAAGAATGACCAAGG - Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942676219 2:178429146-178429168 AGATAACAGAAGAATGAGAATGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942782451 2:179661183-179661205 TGGTAAAAGGAAAATGGGGAAGG + Intronic
942833009 2:180258953-180258975 TGTTAGAAAAAGAGAGAGGAAGG + Intergenic
943043681 2:182832690-182832712 TGTTCAAAGAACAAAGAGAAAGG + Intergenic
943890693 2:193282475-193282497 TATTAATAGAAGAATGAGAGAGG - Intergenic
943934377 2:193896386-193896408 TGAAAAAAGAAGAATGTGTAAGG - Intergenic
943939590 2:193974807-193974829 TATTAAAAAAAAAATCAGGATGG - Intergenic
944105231 2:196072483-196072505 TGTAAAAGGAAGAAGAAGGAAGG + Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944492637 2:200273477-200273499 TGACAAAAGAAGAGTGTGGATGG + Intergenic
945312728 2:208333777-208333799 TTTTAAAAAAAGAGTGAGGCTGG - Intronic
945326878 2:208492416-208492438 TTTTAAAGGGAGAATGAGGGAGG + Intronic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
947154750 2:227150899-227150921 TGTTAAAAAAAAAAAAAGGAGGG - Intronic
948006082 2:234608736-234608758 TGTTAACTGAAGTATGAGAATGG + Intergenic
948131653 2:235605172-235605194 TGTCAAAAGAAACATGAGGCTGG - Intronic
948313787 2:237011098-237011120 TGAAGAAACAAGAATGAGGAAGG + Intergenic
1168849920 20:969512-969534 TGTTCAAAGAGGAATGGGAAGGG - Intronic
1169148639 20:3271529-3271551 TGTTAAAATAGGAATGAATATGG - Intronic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169926383 20:10788727-10788749 TCTTAGAAGACGAATGAGTATGG + Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1171080217 20:22174024-22174046 TGTTCTATGAAGAATGATGATGG + Intergenic
1171568250 20:26216939-26216961 TGTTTAAAGAAGGAGAAGGAAGG + Intergenic
1172105433 20:32514556-32514578 TCTTAAAAAAAGGAGGAGGAGGG - Intronic
1172411304 20:34725467-34725489 TGTGATCAGAGGAATGAGGACGG + Intronic
1172689579 20:36781237-36781259 GGTTAAAAGAAAGATGAGGCTGG + Exonic
1174254445 20:49243778-49243800 AGTTAAGACCAGAATGAGGATGG - Intronic
1174501219 20:50986126-50986148 TTTTAAAAGAAAAAAGAGGCGGG - Intergenic
1175425281 20:58861037-58861059 TCTAAAAAGAAGAAGGAGCATGG - Intronic
1175527177 20:59643204-59643226 TTTTAAAAGAAGAATTAGGCCGG - Intronic
1175644778 20:60661751-60661773 TGTTAAATGATGAATTAAGATGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175688880 20:61051349-61051371 TGTTTAAGAAAGAATGGGGAGGG + Intergenic
1177565111 21:22810577-22810599 TGTTTAAAGAAAAATGGGGTGGG + Intergenic
1177657123 21:24032262-24032284 TGTTAAAAGAAGAAGGTTAATGG + Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178347711 21:31845879-31845901 TGTGAAAAGAATAATGGGGGTGG - Intergenic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1178969532 21:37159787-37159809 TGTTAAACCAAGGATGAGAAGGG + Intronic
1179317555 21:40257897-40257919 TGTGAAAAGAATAAGGAGAAAGG - Intronic
1180886026 22:19244477-19244499 TTTTAACAGAAAAATGAGCATGG + Intronic
1181959107 22:26610333-26610355 TGGGAAAAAAAGAATGAAGAGGG - Intronic
1184587671 22:45458857-45458879 GCTTAAAAGAAGAATAAGGTGGG + Intergenic
1184618044 22:45651455-45651477 TATAAAAAAAAGAAGGAGGAAGG + Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949254849 3:2033787-2033809 TGTTAAAAGAAAAAAGAGGTTGG + Intergenic
949333034 3:2943479-2943501 TGTTAAATCAAGAACGAAGATGG - Intronic
949422678 3:3882794-3882816 TGTCAAAAGATGAAAGATGATGG + Intronic
950458887 3:13109302-13109324 TCTTAAAAGAAGAGAGATGAAGG + Intergenic
950552397 3:13674756-13674778 TGTTTACAGAATAGTGAGGAGGG + Intergenic
951046494 3:18045434-18045456 TATAAAGACAAGAATGAGGATGG - Intronic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952080900 3:29756329-29756351 TCTTCATAGAAGTATGAGGATGG - Intronic
952401576 3:32968316-32968338 TGTCAAAAGAATAAGGAGAATGG + Intergenic
952768803 3:36978375-36978397 TTTTTAAGAAAGAATGAGGATGG - Intergenic
953285586 3:41604206-41604228 TGGTAAAAGCATAATCAGGAAGG + Intronic
953322839 3:41987610-41987632 AGTTTAATGAAGAATGAGAAGGG - Intergenic
953668416 3:44942652-44942674 TGCTAATAGAAGAATGTGTATGG - Intronic
954598394 3:51847490-51847512 TTTTAAAGGGAGAATGAGGGAGG + Intergenic
955049578 3:55397023-55397045 TTTTAAAAGGACAATGAAGATGG + Intergenic
955184397 3:56701232-56701254 TGTTAAAAAAAGAATGTGGTGGG - Intergenic
955667263 3:61364008-61364030 TGTTAAAAAAAAAAAGGGGAGGG + Intergenic
955765033 3:62334693-62334715 TGAAAAAAGAAGACAGAGGAAGG + Exonic
956482159 3:69684052-69684074 TGTTTAAAGAAGAAAGGAGAAGG + Intergenic
957110603 3:75951399-75951421 TGTTTAAAGAAGGAGAAGGAAGG - Intronic
957130101 3:76213462-76213484 TGTGAAAAGAAAAATGAGAATGG + Intronic
957597491 3:82287143-82287165 TGTTGAAAAAAGTAAGAGGAGGG + Intergenic
957847185 3:85753303-85753325 GGCAAAAAGAAGAAAGAGGAAGG + Intronic
958034464 3:88153056-88153078 TGTTAAAAGAAAACTGACAACGG + Intronic
958896105 3:99831467-99831489 TTTTAAAAGACGAAAAAGGAAGG + Intronic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
959274753 3:104264155-104264177 TGTTAAAAGAAAAGTTAGGTGGG - Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959768528 3:110064026-110064048 GGATAAAAGAAGATTGGGGAAGG + Intergenic
959890582 3:111550731-111550753 TCAGAAAAGAAGATTGAGGAAGG + Intronic
960245109 3:115391715-115391737 TGTTAAAGGAAGAAGAAGGAAGG - Intergenic
960365672 3:116769019-116769041 TCTAAATAGAAGAATGATGAAGG + Intronic
960398889 3:117171571-117171593 TATTTAGAGAAGACTGAGGAAGG - Intergenic
961344485 3:126254681-126254703 TGTTTACAGAAGCATAAGGAAGG - Intergenic
961942565 3:130653508-130653530 TGTTTAGAGAAGAAAGAGTAAGG + Intronic
962107944 3:132413046-132413068 TTTTCAAAGATGGATGAGGAGGG - Intergenic
962240880 3:133749858-133749880 TTTTAAAGGGAGAATGAGGGAGG + Intronic
962418609 3:135206889-135206911 TCTTAAAAGAAGGATAATGAAGG - Intronic
962513422 3:136125996-136126018 GGTTAAAAGAAAAAAAAGGAGGG + Intronic
962797343 3:138860894-138860916 TCTTCAAAGAACAAAGAGGAAGG + Intergenic
963379492 3:144509540-144509562 AGTTAAAAAAAAAAAGAGGAGGG - Intergenic
963635992 3:147796746-147796768 TTTTAAAAAAAGAACGAGAAAGG + Intergenic
964067076 3:152593330-152593352 GGAGAAAAAAAGAATGAGGAGGG + Intergenic
964086319 3:152822958-152822980 TGTAAAAAGTAGAATCAGGCAGG - Intergenic
964869066 3:161293175-161293197 TTTTAAGGGAAAAATGAGGAGGG + Intergenic
965070490 3:163910764-163910786 TGTGAAATGAATAATGTGGAGGG - Intergenic
965525434 3:169711772-169711794 TATTAAAAGAATAATAAGGGAGG - Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966680732 3:182639370-182639392 AGTTAAAACAATAATGAGGCTGG + Intergenic
967008955 3:185413523-185413545 TGTTAAAAACAGAATGGGGCTGG + Intronic
967459293 3:189726583-189726605 TGCTAAAATATTAATGAGGATGG + Intronic
967482115 3:189985029-189985051 TTTTAAAAGAATAATAAGTAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967877472 3:194277012-194277034 TGTTAAAAGATGAAGGAAGCTGG - Intergenic
968238042 3:197049457-197049479 TGTCAAAAGATGAATGAGCCGGG + Intronic
968361449 3:198149472-198149494 TGTGAAGAGAAGACTGATGAGGG - Intergenic
968556836 4:1249789-1249811 TGTTAAAAGAGAAATGGGGTCGG - Intronic
969220580 4:5756016-5756038 TGTTAAAGCCAGGATGAGGAGGG - Intronic
970392048 4:15622127-15622149 TGTTAAAAGAGCATTGAGGCTGG - Intronic
970815326 4:20149411-20149433 TGTTAAAAGAAGTAAAAGGCAGG + Intergenic
972285901 4:37648043-37648065 TGTTTCAATAAGAACGAGGAAGG + Intronic
972586677 4:40443900-40443922 TATTAAAAGATAAATGAGGCTGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
974164796 4:58187679-58187701 TATTAACAAAAGAATGTGGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974356414 4:60818484-60818506 TGTTAAGAACAGAATGAAGAGGG - Intergenic
974358317 4:60841521-60841543 TTTTAAAAAGAGATTGAGGAAGG + Intergenic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
975146442 4:70972620-70972642 TGTCAAAGGTAGAATGAGAAAGG + Intronic
975157085 4:71084047-71084069 TGTTCAAAAAGGGATGAGGAGGG + Intergenic
975172998 4:71254499-71254521 TGAAAAAAGAAAAATGAGAATGG + Intronic
975229147 4:71910393-71910415 TGTAAAAATAAGAATTAGAATGG - Intergenic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975362965 4:73493248-73493270 TTTTAATGGAAGAATGAGGAAGG + Intronic
975452293 4:74543230-74543252 TGTAAAAAGAAGAATGCTTATGG - Intergenic
975612027 4:76213250-76213272 GGGTTAAAGAAGGATGAGGAAGG - Intronic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
976095958 4:81508505-81508527 TGTTAAAATAGAAGTGAGGAAGG - Intronic
976674342 4:87687576-87687598 TGTTAAAAGATGGGTGAGGCTGG - Intergenic
977136849 4:93315455-93315477 AGATTAAAGAAGAATTAGGAGGG - Intronic
977858137 4:101920935-101920957 GATAAAGAGAAGAATGAGGAAGG + Intronic
978191452 4:105917407-105917429 TGTTAAAAGAATACAGAAGAAGG - Intronic
978515245 4:109561514-109561536 TGTTTGAAAGAGAATGAGGAAGG + Intronic
978536901 4:109771936-109771958 TGTTGAAACAAGGTTGAGGAGGG + Intronic
978554945 4:109969986-109970008 TGTTAAAACAAGCATGAAGGAGG + Intronic
978668532 4:111216467-111216489 ACTAAAACGAAGAATGAGGATGG - Intergenic
978765474 4:112400864-112400886 TGTGAAGAGAAGAGAGAGGAAGG + Intronic
978987309 4:115029149-115029171 TGTTTAAAGAAGTATCAGTAAGG + Intronic
979544659 4:121926278-121926300 TTTTAAAGGAAAAGTGAGGAGGG - Intronic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
981308296 4:143269404-143269426 TATTGAAAGAAGATTCAGGATGG - Intergenic
981781163 4:148431227-148431249 TTTTAAAGTAAAAATGAGGAGGG - Intronic
982283501 4:153710756-153710778 TGCTAAAAGAAGGAAGAAGAGGG + Intronic
982562904 4:156952709-156952731 TGTTACTAGAAGGTTGAGGAAGG - Intronic
982838188 4:160150182-160150204 GGTTGAAAGAAGAATGAGTTAGG + Intergenic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
984233745 4:177131624-177131646 TGCTACAAGAAGAATAAAGAGGG + Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
986773887 5:10996391-10996413 TCTCAAAAGAGCAATGAGGAGGG + Intronic
987011409 5:13770002-13770024 AGTCAAAAGAAGAATGATGTGGG + Intronic
987097490 5:14562823-14562845 TGTTACCAGAAGAAAGAGGGAGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987202213 5:15588889-15588911 TTTTAAAAAAAGAAAGAGGTTGG - Intronic
987785213 5:22490644-22490666 AGTTAAAAAAAAACTGAGGATGG + Intronic
988093496 5:26570635-26570657 TGTTAAAATATGAATGATAAAGG - Intergenic
988214644 5:28255913-28255935 TCTTAAAAGAAGAATGGTCAAGG + Intergenic
988535523 5:32064537-32064559 TGTTAAAAGTGGATTGAGGCCGG - Intronic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
989150502 5:38294655-38294677 TGTTAAAAAAAAAATTAGAAAGG + Intronic
989723859 5:44563266-44563288 TTTTAAAAGAAGAATAAAGTTGG - Intergenic
989751346 5:44897583-44897605 TGTTGAAAGAAAAGAGAGGAAGG - Intergenic
990172697 5:53071742-53071764 GGCTAAAAGCAGAATTAGGATGG + Intronic
991550100 5:67826259-67826281 TGTTAAAGAAAGAAAGAGAAAGG + Intergenic
991603828 5:68380375-68380397 TATTGAAAGAAGAATTAGGAAGG - Intergenic
992475527 5:77098275-77098297 TTTTAAAAAAAAAAAGAGGAAGG - Intergenic
992870674 5:81002402-81002424 TTTTAAACGAATAATGATGAGGG + Intronic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993181958 5:84564544-84564566 TGCTAAAAGAGGAATGAGTCAGG - Intergenic
995327775 5:110911083-110911105 TGAGGAAAGAAGAAAGAGGAGGG + Intergenic
995364221 5:111337649-111337671 TGTCAAAAGAACAAAGAGGTTGG + Intronic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
995739090 5:115335652-115335674 TGTTCAAAGAAGTCTGAGGGTGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995992009 5:118251545-118251567 TGATAAAAAAAGAATGAAGCTGG + Intergenic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996581053 5:125032808-125032830 TGGGAAAAGAACAATTAGGATGG + Intergenic
996853804 5:127982092-127982114 TGTCAAAAAGAGAATGAGCAGGG + Intergenic
996919690 5:128753356-128753378 TGTTATCAGAAGAATGTGAATGG - Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997258684 5:132448852-132448874 TGTTAACAGATAAGTGAGGAGGG - Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997743198 5:136275884-136275906 TGTTGAAAGCAGAAAGAGAATGG + Intronic
997815990 5:137017752-137017774 TATTAAAAGATGAATAAAGAGGG + Intronic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
998921842 5:147077718-147077740 TTTAAAAAGAAGAATTAGGTTGG - Intronic
999071433 5:148747763-148747785 TGCTAAAAGAATTAAGAGGAGGG + Intergenic
999072799 5:148765362-148765384 TGCTAAAAGTAAAATGAGAAAGG - Intergenic
999409061 5:151334391-151334413 TTATAAAAGAAGAATTAGGCTGG + Intronic
999494806 5:152086192-152086214 TTTTAAAAAAAGAATGGGGTTGG - Intergenic
1000080721 5:157843591-157843613 TTTTAAATGAAGAGTGAGAAGGG - Intronic
1001189202 5:169611388-169611410 TCTTAAAAGAAGCCTGAGGGGGG + Intergenic
1001440895 5:171742003-171742025 TCTCAACAAAAGAATGAGGAGGG + Intergenic
1001663846 5:173416301-173416323 TGTACACAGAAGAATAAGGAAGG + Intergenic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002493708 5:179597891-179597913 TGTAGAAAGCAGAATGAGGCCGG + Intronic
1002947033 6:1772159-1772181 TGTTACAAGGAAAATGAAGAAGG + Intronic
1003025476 6:2551211-2551233 TCTGAAAAAAAGAATTAGGAGGG + Intergenic
1003453132 6:6255840-6255862 TTTAAAAAGAAGATTGAGGGTGG + Intronic
1004148638 6:13093450-13093472 TGTGATAAGGAGAATGATGATGG - Intronic
1004221410 6:13750429-13750451 TTTAAAAAGAAGAATGAAGGTGG - Intergenic
1004792311 6:19040384-19040406 TGTGAAGAGAAGAATGGAGAAGG + Intergenic
1004800583 6:19142646-19142668 TCCTAAAAAAAGAATGATGATGG + Intergenic
1004987521 6:21099326-21099348 TGTTAATAAAGGAATGAGCACGG + Intronic
1005031983 6:21517975-21517997 AGTTAAAAGATGAATGAGTACGG + Intergenic
1005078715 6:21934996-21935018 TGTTTAAAGAAGTAAGAGGCCGG - Intergenic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1005881567 6:30066356-30066378 TGGTAAAACAAGAACCAGGAAGG - Intergenic
1007056365 6:38889667-38889689 TGTTATAAGAAGCATGAGATAGG - Intronic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007503885 6:42319524-42319546 TGTTAAAAAAAGTATGAGCCTGG + Intronic
1008465689 6:51828102-51828124 TGGTAAGAGAAGAATGTGGAGGG + Intronic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1008877800 6:56348517-56348539 TGGTAAAATGAGAATAAGGAGGG + Intronic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010100432 6:72099230-72099252 TGTTTAAAGAAAATTGAGGTAGG + Intronic
1010399090 6:75427987-75428009 GGTTGAAGGAAGAGTGAGGAAGG + Intronic
1011052073 6:83163136-83163158 TTTTTAAAGAAGAAAAAGGAAGG + Intronic
1011845103 6:91553173-91553195 TGTTAATAGTTGCATGAGGAAGG - Intergenic
1011976652 6:93309243-93309265 TGTTAAAAGATGTTTGAGGCTGG - Intronic
1011984090 6:93419816-93419838 TGTTCAGAGGAGAACGAGGATGG + Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012271693 6:97220279-97220301 AGGTAAAAGAAGACTGTGGATGG + Intronic
1012363880 6:98416280-98416302 TGTTAGAAGAAGAAAGAAGGTGG - Intergenic
1012382138 6:98632742-98632764 TGTTATAAAAAGAATGAGTTGGG + Intergenic
1012576169 6:100802701-100802723 TATTAAAAGCAGAATCAGGCTGG + Intronic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1015158912 6:130129470-130129492 TGTTGAATCAAGAATCAGGAAGG + Intronic
1015166010 6:130200731-130200753 TCTTTAAACAAAAATGAGGAGGG + Intronic
1015168497 6:130225360-130225382 TGGGAAAACAAGAATGTGGAAGG + Intronic
1015602552 6:134924502-134924524 TTTTAAAGGTAAAATGAGGAAGG - Intronic
1015837474 6:137436411-137436433 TGTTAAAAAAAGAAATGGGAAGG + Intergenic
1015843251 6:137494647-137494669 AGTTAAAAAAAAAATCAGGAAGG - Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1016405875 6:143730103-143730125 TTTTAAATGAAGAATAAGGTTGG - Intronic
1016682053 6:146842459-146842481 TGATAAAAGAGGACTGAAGAAGG - Intergenic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017690523 6:156959577-156959599 TCTTAAAAGGAGGATCAGGAGGG + Intronic
1018005217 6:159615794-159615816 TGGGGAAATAAGAATGAGGAAGG + Intergenic
1018459153 6:163981047-163981069 TGATAAAAGAGGCATGAGGGAGG - Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019254241 7:39248-39270 TGTGAAGAGAAGACTGATGAGGG + Intergenic
1020089225 7:5328825-5328847 TATTAAAAGAAAAATTAGCAAGG + Intronic
1020444505 7:8255200-8255222 TGTGAAGAGAAGGAAGAGGATGG - Intronic
1021301687 7:18981118-18981140 TATTAAAAGAAGAAACAGGCCGG - Intronic
1022051712 7:26680849-26680871 TGTTAAAAAGGGAAGGAGGAAGG + Intronic
1022350889 7:29565450-29565472 AGTAAAAGGAAGAATTAGGATGG + Intronic
1022568687 7:31429701-31429723 TGTTTAAAGAATAATGAGCTTGG - Intergenic
1022701528 7:32764611-32764633 TGTTAAAGGAAAAATGAAGCAGG + Intergenic
1022751748 7:33235228-33235250 TCATAAAAAAAGAAAGAGGAAGG - Intronic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023378627 7:39584154-39584176 TTTTAAAAGAAAACTAAGGAAGG + Intronic
1023732047 7:43201410-43201432 TGTTAACACAAAAAGGAGGAAGG + Intronic
1023775936 7:43607350-43607372 TGTTAAAGCAAGAATGGGGCCGG + Intronic
1024355442 7:48409776-48409798 CATCCAAAGAAGAATGAGGAGGG + Intronic
1024470372 7:49763660-49763682 TGTTATCAGAAGAAAGAGAATGG + Intergenic
1024753931 7:52505528-52505550 TGAAAAAAGAATATTGAGGATGG + Intergenic
1026799109 7:73386832-73386854 AGTTAAGAGAAGAAAGAAGAAGG + Intergenic
1027148279 7:75713994-75714016 TGTTAAAAAAAAAAAGAGGCTGG - Intronic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027503436 7:78984419-78984441 TGTTAAAGGAAGGGTGAGGGAGG - Intronic
1028123242 7:87081643-87081665 TGTGAAAAGCAGAATGAGAGAGG + Intergenic
1029236860 7:99127316-99127338 TGTTAAAAGAAAAAGAGGGAGGG + Intronic
1029545760 7:101209835-101209857 TCTTAAAAGAAGAATGGGGCTGG - Intronic
1030728955 7:112961609-112961631 TGTTGAAAGGAGAATGTGAATGG - Intergenic
1031236392 7:119184340-119184362 TGCAGAAAGAAGAATGTGGAAGG + Intergenic
1031326565 7:120406803-120406825 TTTTAAGATAAGAATGAGCATGG + Intronic
1031403708 7:121357052-121357074 TGGTCAAAGAAGTTTGAGGATGG - Intronic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032750629 7:134836859-134836881 TGTTAATAGAAGAATGAGGGTGG - Intronic
1033026387 7:137777195-137777217 TGTTAAAAAAAGGATGAGGCGGG + Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033992955 7:147310752-147310774 TGTTAAAAGCATAGTAAGGAAGG + Intronic
1034384147 7:150724426-150724448 TGTAAAGAGAATTATGAGGAGGG - Intronic
1034921869 7:155089776-155089798 TGAGAAAAAAAGGATGAGGAGGG + Intergenic
1035102260 7:156410498-156410520 ACTTAACAGAAGAATGAAGATGG - Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035981376 8:4375790-4375812 TCTTAAAAAATGTATGAGGATGG - Intronic
1036053613 8:5226869-5226891 TTTTAAAAGGAAAATGAAGAAGG - Intergenic
1036190320 8:6664138-6664160 TGTTAAAAGAAATAAAAGGACGG + Intergenic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1036981121 8:13471442-13471464 TGTGGAAAAAAGAGTGAGGAAGG + Intronic
1038013842 8:23496849-23496871 TGTTAAAATAAAAAAAAGGAGGG + Intergenic
1038783167 8:30586132-30586154 TGTTAAAGGAAAAGGGAGGAAGG - Intronic
1039701241 8:39963952-39963974 TGTTTAAAGAAGAATCTGGGTGG + Intronic
1039829128 8:41199034-41199056 TCTTTAAAGAAGTATGAGAATGG + Intergenic
1040356043 8:46619315-46619337 TGTTAAAACAAAATTGAGGCTGG + Intergenic
1040681003 8:49809038-49809060 TGTTAAAAGAAGGAAGGGAATGG + Intergenic
1040698284 8:50029357-50029379 TTTTAAAATAACAAAGAGGATGG - Intronic
1041107251 8:54455190-54455212 TGTTATAAGAAGTAGGGGGAGGG + Intergenic
1041114317 8:54519911-54519933 TTTGAAAAGAAGAATCAGAAGGG + Intergenic
1041833375 8:62182229-62182251 TAATGAAAGTAGAATGAGGAGGG + Intergenic
1042277205 8:67018412-67018434 TCTTAAAAGAAAAAAGAGGTCGG - Intronic
1042301964 8:67293567-67293589 TCTATAAAAAAGAATGAGGAAGG + Intronic
1042686339 8:71445200-71445222 AGTTTTAAAAAGAATGAGGATGG - Intronic
1042860368 8:73307173-73307195 TGATAAAAGAAGGATTAGAAAGG + Intronic
1043538387 8:81231576-81231598 TGCTAAACGAGGAGTGAGGAAGG + Intergenic
1044071485 8:87766079-87766101 TATTAAAAGAAGAAATAGGTAGG - Intergenic
1044153589 8:88814781-88814803 TGTAAAATGAACAATGGGGAAGG + Intergenic
1044298059 8:90551355-90551377 TTGTAAAACAAGAATGATGATGG - Intergenic
1044608683 8:94070815-94070837 TTTTAAAAGATGAATCAAGATGG - Intergenic
1044641450 8:94386174-94386196 TGGTACCAGAAAAATGAGGATGG + Intronic
1044648679 8:94471355-94471377 TGTAAAAATTAGAATGAGGCTGG - Intronic
1044877761 8:96688386-96688408 CATTAAAAGAAAAATGAGGTGGG - Intronic
1046031171 8:108785489-108785511 TGTAAAAAGACAAATGAGAAAGG + Intronic
1046200463 8:110921157-110921179 TATTAAATGTAGAGTGAGGAGGG + Intergenic
1046597498 8:116278076-116278098 TATTAAAAAAAAAAAGAGGAGGG + Intergenic
1047011790 8:120680572-120680594 TGTCAAAAGAAGAAAGAGCAGGG + Intronic
1047398721 8:124527952-124527974 TGTTAAAACCAGAATTATGATGG - Intronic
1047435660 8:124833754-124833776 TGCTAAGAGAGGAATGGGGAGGG - Intergenic
1047790882 8:128202466-128202488 TGTTAACACAAGAAGGAGGAAGG + Intergenic
1049969056 9:805590-805612 TCTTAAAAAAAGAAAAAGGAAGG + Intergenic
1049972563 9:834281-834303 TGTTAAAAAAAAAATCAGGGCGG + Intergenic
1050215826 9:3322073-3322095 TGTAAAAAGAAAAATAATGAGGG - Intronic
1050368306 9:4894189-4894211 TGAAACACGAAGAATGAGGAAGG - Intergenic
1050485607 9:6131528-6131550 TCTTCAAATAAGAATGAGGTTGG - Intergenic
1050644974 9:7709773-7709795 TGGTAAAAGGAGAAAGAGTATGG + Intergenic
1050760033 9:9057556-9057578 TGTTAAATGATGAATGAAAAAGG + Intronic
1050760958 9:9070388-9070410 TGCTCAAAGAAAAATGAGAATGG - Intronic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1050874986 9:10623105-10623127 TGTGAAAAGATGAATTTGGAGGG - Intergenic
1051591766 9:18783297-18783319 TTTTAAAAGTAGATTGAAGAGGG + Intronic
1051993885 9:23189850-23189872 TTTTGAAAGGAGAATGAGAAAGG - Intergenic
1052500440 9:29282240-29282262 TGTTTAAAGGAGAATGTGTAAGG + Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053659645 9:40259717-40259739 AATTAAAAAAAGAATGAGGTAGG + Intronic
1054524953 9:66116499-66116521 AATTAAAAAAAGAATGAGGTAGG - Intronic
1054679392 9:67895733-67895755 AATTAAAAAAAGAATGAGGTAGG + Intronic
1054830266 9:69617167-69617189 TCTTAAAGGAAAAGTGAGGAGGG - Intronic
1055302111 9:74892461-74892483 AGTTGAAGGAAGAATGAGAAGGG + Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056066647 9:82942402-82942424 TTTTAAGAGGAGAAAGAGGATGG + Intergenic
1056469780 9:86894207-86894229 AGCAAAAAGAAGCATGAGGAAGG - Intergenic
1056618456 9:88188976-88188998 TGTTAAGAAAAAAATCAGGAAGG - Intergenic
1057743276 9:97731348-97731370 TGTTATAAGAAGAATAAGTACGG - Intergenic
1057954232 9:99395166-99395188 AGATAAAAGAAGAATAAGAATGG - Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1059049870 9:110912426-110912448 TTTTAAAAAAAGAATTAGTAGGG + Intronic
1059431824 9:114255034-114255056 TGTCCAAAGAATCATGAGGATGG - Intronic
1059920708 9:119157213-119157235 TGGCAAGAGAAAAATGAGGAAGG - Intronic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1060447131 9:123700185-123700207 TTTTAAAAGAAGAATAAAGTTGG - Intronic
1061617378 9:131789231-131789253 TGTCAAAAAAAGAAGAAGGAAGG - Intergenic
1061686158 9:132281049-132281071 TATTTAAACAAAAATGAGGAGGG + Intronic
1062746161 9:138213293-138213315 TGTGAAGAGAAGACTGATGAGGG - Intergenic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186107524 X:6223550-6223572 TGCTCCAAGAAAAATGAGGAAGG + Intronic
1186271566 X:7893995-7894017 TGTTAAAAAAAGAATGCATATGG - Intergenic
1186420948 X:9425972-9425994 TGGGAATAGAAGAATGGGGAAGG + Intergenic
1187166720 X:16811354-16811376 TCTTAAAAAAAAAATAAGGAAGG - Intronic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188176474 X:26996843-26996865 AGTTTAATGAAGAATGATGATGG + Intergenic
1188499723 X:30811857-30811879 TTATAAAAGAAGGATGAGGCAGG - Intergenic
1188850909 X:35131119-35131141 TGTGGAAAGAAGACTGGGGATGG - Intergenic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1189167219 X:38872075-38872097 TGTGAAAAAAAGAAAGAGAAAGG - Intergenic
1189455805 X:41188395-41188417 TGATAAAAGAAAAAAGAGAATGG - Intronic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190299081 X:49045741-49045763 TTACAAAAGAAGAAAGAGGAGGG + Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192298448 X:69875096-69875118 AGTTATATGAAGAATGATGATGG - Intronic
1193561335 X:83021424-83021446 TTTAAAAAGAAGAATGAAGTTGG + Intergenic
1193980471 X:88175992-88176014 GGTTGAATAAAGAATGAGGAGGG - Intergenic
1195176222 X:102317805-102317827 GGTAAAAAGAAGAAATAGGAGGG - Intronic
1195182642 X:102369288-102369310 GGTAAAAAGAAGAAATAGGAGGG + Intronic
1196161902 X:112494427-112494449 TGATAAAAGAAAATTGAAGAGGG - Intergenic
1196173533 X:112616128-112616150 TCTTCATAGAAGCATGAGGATGG + Intergenic
1196634816 X:117990259-117990281 TTATGATAGAAGAATGAGGATGG + Intronic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197494926 X:127167168-127167190 TGTAAAAAGGCAAATGAGGAAGG + Intergenic
1197976643 X:132172604-132172626 TGCTAAAACAACAAGGAGGAGGG - Intergenic
1198459178 X:136847090-136847112 GGTTGAAAGAAGAATGGAGAAGG - Intergenic
1198842950 X:140878773-140878795 TTTTAAGAGAAGAAAGATGAAGG - Intergenic
1198854171 X:140998495-140998517 TGTTAGAAGGAGATTGAAGATGG - Intergenic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic
1200340739 X:155392600-155392622 TGTGAAAAAAAAAATGAGAATGG - Intergenic
1200414778 Y:2898356-2898378 TGTGAAAAGAAGCTTGAGGATGG + Intronic
1200713328 Y:6509474-6509496 TGTGAAAAGAAGATTAATGATGG - Intergenic
1201020592 Y:9652567-9652589 TGTGAAAAGAAGATTAATGATGG + Intergenic
1202275538 Y:23115562-23115584 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202290490 Y:23305129-23305151 TGTTAAAATTAAAAGGAGGAAGG - Intergenic
1202428530 Y:24749281-24749303 TGTTAAAATTAAAAGGAGGAAGG + Intergenic
1202442261 Y:24920808-24920830 TGTTAAAATTAAAAGGAGGAAGG - Intergenic