ID: 918048346

View in Genome Browser
Species Human (GRCh38)
Location 1:180954407-180954429
Sequence ACGCGTGCGCGCGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918048346_918048352 25 Left 918048346 1:180954407-180954429 CCCCAGCACACGCGCGCACGCGT No data
Right 918048352 1:180954455-180954477 CCCTGCCTTTGAGAAACGCACGG No data
918048346_918048354 29 Left 918048346 1:180954407-180954429 CCCCAGCACACGCGCGCACGCGT No data
Right 918048354 1:180954459-180954481 GCCTTTGAGAAACGCACGGCTGG No data
918048346_918048356 30 Left 918048346 1:180954407-180954429 CCCCAGCACACGCGCGCACGCGT No data
Right 918048356 1:180954460-180954482 CCTTTGAGAAACGCACGGCTGGG No data
918048346_918048350 -2 Left 918048346 1:180954407-180954429 CCCCAGCACACGCGCGCACGCGT No data
Right 918048350 1:180954428-180954450 GTACACGCACACACACTGCTGGG No data
918048346_918048349 -3 Left 918048346 1:180954407-180954429 CCCCAGCACACGCGCGCACGCGT No data
Right 918048349 1:180954427-180954449 CGTACACGCACACACACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918048346 Original CRISPR ACGCGTGCGCGCGTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr