ID: 918048660

View in Genome Browser
Species Human (GRCh38)
Location 1:180956051-180956073
Sequence CTCTGGCTTTGTAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918048660_918048664 -6 Left 918048660 1:180956051-180956073 CCCTCTTTCCTACAAAGCCAGAG No data
Right 918048664 1:180956068-180956090 CCAGAGCACCTGCTTAGAAATGG No data
918048660_918048666 10 Left 918048660 1:180956051-180956073 CCCTCTTTCCTACAAAGCCAGAG No data
Right 918048666 1:180956084-180956106 GAAATGGCAAGAGCCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918048660 Original CRISPR CTCTGGCTTTGTAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr