ID: 918048660 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:180956051-180956073 |
| Sequence | CTCTGGCTTTGTAGGAAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918048660_918048664 | -6 | Left | 918048660 | 1:180956051-180956073 | CCCTCTTTCCTACAAAGCCAGAG | No data | ||
| Right | 918048664 | 1:180956068-180956090 | CCAGAGCACCTGCTTAGAAATGG | No data | ||||
| 918048660_918048666 | 10 | Left | 918048660 | 1:180956051-180956073 | CCCTCTTTCCTACAAAGCCAGAG | No data | ||
| Right | 918048666 | 1:180956084-180956106 | GAAATGGCAAGAGCCTTCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918048660 | Original CRISPR | CTCTGGCTTTGTAGGAAAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||