ID: 918050878

View in Genome Browser
Species Human (GRCh38)
Location 1:180971588-180971610
Sequence CACCTACAACTGTTGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918050872_918050878 -7 Left 918050872 1:180971572-180971594 CCTCTTTGGCCTGCCCCACCTAC 0: 1
1: 0
2: 3
3: 26
4: 269
Right 918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG 0: 1
1: 0
2: 0
3: 6
4: 101
918050868_918050878 25 Left 918050868 1:180971540-180971562 CCGACTGCTCTCTGCCTCCAGTA 0: 1
1: 0
2: 1
3: 44
4: 380
Right 918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG 0: 1
1: 0
2: 0
3: 6
4: 101
918050870_918050878 8 Left 918050870 1:180971557-180971579 CCAGTAACTCAGCATCCTCTTTG 0: 1
1: 0
2: 2
3: 20
4: 210
Right 918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG 0: 1
1: 0
2: 0
3: 6
4: 101
918050869_918050878 11 Left 918050869 1:180971554-180971576 CCTCCAGTAACTCAGCATCCTCT 0: 1
1: 0
2: 1
3: 16
4: 206
Right 918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG 0: 1
1: 0
2: 0
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918050878 Original CRISPR CACCTACAACTGTTGTGGCA TGG Intergenic
901991590 1:13118803-13118825 CACCTCCAGCTGTTGAGGAATGG - Intergenic
903153792 1:21430667-21430689 CGCCTACAGCTGTTTTGCCAAGG - Intergenic
904938174 1:34146535-34146557 CTCTTACAACTGCAGTGGCAGGG - Intronic
905865584 1:41374596-41374618 CACCTACCCCTAATGTGGCAGGG - Intronic
909504868 1:76377407-76377429 AACTTACAACTGTGGTGGGAGGG + Intronic
910520603 1:88117810-88117832 CACCCACCAATGTTTTGGCATGG - Intergenic
911584531 1:99675453-99675475 CATCAACTACTGTTGTGGCCAGG - Intronic
912304789 1:108556515-108556537 CCTCTATAACTATTGTGGCAGGG + Intergenic
912495545 1:110089139-110089161 CACCTAAGACTGTTGAGGGAGGG + Intergenic
914995278 1:152538032-152538054 CAGCTCCAACTTCTGTGGCAGGG - Intronic
915908183 1:159894960-159894982 AACCTAGAACTGGTCTGGCAAGG - Intronic
918050878 1:180971588-180971610 CACCTACAACTGTTGTGGCATGG + Intergenic
920019712 1:202946190-202946212 CACCTAGAACAGTTCTGCCAGGG + Intronic
922308438 1:224365248-224365270 CATCAACAGCTTTTGTGGCAGGG - Intronic
923193931 1:231646159-231646181 CACCAGGGACTGTTGTGGCATGG - Intronic
923413311 1:233731076-233731098 CACCTGCAGCTGTTGTGGTGGGG + Intergenic
1063077566 10:2732137-2732159 CACCAACCACTGCTGAGGCATGG + Intergenic
1074426689 10:113357848-113357870 GACCTACAAATCTTGTGACAGGG - Intergenic
1078147619 11:8732517-8732539 TACTTACAAGTGCTGTGGCAGGG - Intronic
1081021060 11:37948088-37948110 CAGCTGCCACTGTTGTGCCAGGG - Intergenic
1082163276 11:48908405-48908427 CACCTACAAGTTTTCTTGCATGG + Intergenic
1082169535 11:48986234-48986256 CACCTACAAGTTTTCTTGCATGG - Intergenic
1082234676 11:49809853-49809875 CACCTACAAGTTTTCTTGCATGG + Intergenic
1082608379 11:55270548-55270570 CACCTACAAGTTTTCTTGCATGG + Exonic
1082611418 11:55302829-55302851 CACCTACAAGTTTTCTTGCATGG - Intergenic
1082658501 11:55880858-55880880 CACCTACAAGTTTTCTTGCATGG + Intergenic
1084902282 11:72318564-72318586 CAACCACAACTTTTGTGACAGGG - Intronic
1085452028 11:76639905-76639927 CAGCTGCAGCTGATGTGGCATGG + Intergenic
1086696297 11:89850406-89850428 CACCTACAAGTTTTCTTGCATGG + Intergenic
1086702229 11:89911953-89911975 CACCTACAAGTTTTCTTGCATGG - Exonic
1086703938 11:89932497-89932519 CACCTACAAGTTTTCTTGCATGG + Intergenic
1086709859 11:89994083-89994105 CACCTACAAGTTTTCTTGCATGG - Intergenic
1088772542 11:113049647-113049669 GACCTACACTTTTTGTGGCAGGG - Intronic
1093490749 12:19701276-19701298 CACCATCAACAGTTGTAGCAAGG - Intronic
1094069538 12:26397646-26397668 CACCTACAACTGTTGGAGGAAGG + Intronic
1102893742 12:116581963-116581985 CTCCTACAGCTGCTCTGGCAGGG - Intergenic
1106629772 13:31459018-31459040 CACTCACAAATGGTGTGGCATGG - Intergenic
1109276806 13:60312533-60312555 CACCTACAACAGTCCAGGCATGG - Intergenic
1110414899 13:75241308-75241330 CACCGGGGACTGTTGTGGCATGG - Intergenic
1117880047 14:60304452-60304474 AACCTACACCAGTTGTGGCTAGG + Intergenic
1120586848 14:86322305-86322327 CAGCTACAACTGTGGTGGGAAGG - Intergenic
1121309598 14:92928468-92928490 CACCTCCTACTGTTGTTGGAGGG + Intronic
1122392973 14:101403088-101403110 CAGCCACAACTGTTCTGCCAGGG + Intergenic
1124051184 15:26198746-26198768 CACCTCCAACTGTAGTCACATGG + Intergenic
1125233016 15:37479115-37479137 GACCTGCAACTTTTGTGGGAAGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1139821122 16:69722142-69722164 CATCTGCAACTTTTTTGGCAGGG + Intronic
1140838984 16:78821350-78821372 CACATACACCTGTTGTGGGGTGG - Intronic
1141955228 16:87366410-87366432 CACCCACGGCTGTGGTGGCAAGG + Intronic
1147522979 17:41192251-41192273 CACCAACAACTAGTGTGACATGG + Intronic
1148069188 17:44897513-44897535 CCCCTCCAACTGTTTTTGCATGG + Intronic
1156386870 18:36613119-36613141 CACCTACAACTGGGCAGGCAGGG - Intronic
1157548174 18:48562464-48562486 TAACTAGAACTGATGTGGCATGG + Intronic
1158808499 18:61003468-61003490 TACATCCAACTGTTGTGGAAAGG + Intergenic
929115246 2:38438476-38438498 CACCTATAACTGTTGGAGCAGGG - Intergenic
936092723 2:109511552-109511574 GGCCAACCACTGTTGTGGCAAGG + Intergenic
938063029 2:128267008-128267030 CACCTACAGCTGTTTTGCCAAGG + Exonic
938281908 2:130069895-130069917 CACCGAGAACTGTTGTGGGGTGG + Intergenic
938332529 2:130458450-130458472 CACCGAGAACTGTTGTGGGGTGG + Intergenic
938357277 2:130662218-130662240 CACCGAGAACTGTTGTGGGGTGG - Intergenic
938433710 2:131269005-131269027 CACCGAGAACTGTTGTGGGGTGG - Intronic
944388365 2:199189835-199189857 CACATAAAACTGTTGTGCTATGG + Intergenic
947021608 2:225683651-225683673 CACCTAAAAATGAGGTGGCATGG - Intergenic
1174331407 20:49821980-49822002 CACCTACCAGTGGTGTGACAGGG + Intronic
1176169158 20:63689316-63689338 CACCTCCAACTCTTGTGGCCAGG - Intronic
1176957015 21:15117296-15117318 CACCTAAAACAGTGGAGGCAAGG - Intergenic
1181266990 22:21636171-21636193 CTCCTACAACTGTTGGGCCTGGG - Intronic
953771242 3:45779972-45779994 CTCCTACTCCTGTTCTGGCACGG + Intronic
954218066 3:49135374-49135396 CACCTACAACTCCTAGGGCAGGG + Intergenic
954574887 3:51670590-51670612 CCCCTAGAACTGTCCTGGCAAGG + Intronic
955588499 3:60508424-60508446 CACCTGTAACTGTGGTGGCAGGG - Intronic
959749717 3:109819233-109819255 CAGTTACAACTGATGTGACACGG - Intergenic
966913188 3:184570537-184570559 CACCTACAGGTGATGGGGCAGGG - Intronic
967187194 3:186954482-186954504 CACCAACATCTGTTGTTTCACGG + Intronic
969190021 4:5510647-5510669 CACCAGCAACTGTTGTTGCCTGG - Intergenic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
978516880 4:109577969-109577991 CACATAAAACTGATGTGGCTAGG - Intronic
980871331 4:138614455-138614477 CACCCACAATTGATGTGACAGGG - Intergenic
982373708 4:154663097-154663119 CACCTGGGCCTGTTGTGGCATGG + Intronic
995152593 5:108866420-108866442 CACCAAGGACTGTTGTGGGATGG + Intronic
1000959384 5:167581043-167581065 CACGTACATCAGTTGTGGCTTGG + Intronic
1003957672 6:11179254-11179276 CACCTCCAAATGCTGTTGCAAGG - Intergenic
1004595242 6:17093522-17093544 CACCTGGAAGTGTGGTGGCAAGG + Intergenic
1006123183 6:31820169-31820191 CAACTACCACTACTGTGGCATGG + Intergenic
1008628119 6:53337402-53337424 CACCTTTTCCTGTTGTGGCATGG - Intronic
1011237222 6:85230769-85230791 CACCCACAAGTGCTTTGGCAGGG + Intergenic
1011618813 6:89222892-89222914 CAGCCACAACTGTGGTGCCAAGG + Intronic
1012585981 6:100923126-100923148 CACATACAACTTTTGAGGCCAGG - Intergenic
1014725030 6:124962843-124962865 CAGCTCCAACTGCAGTGGCAAGG - Exonic
1019815114 7:3194020-3194042 CCCCCACAATTGTCGTGGCAGGG - Intergenic
1023476717 7:40587606-40587628 CACCTCCAACTGCTTTGCCATGG - Intronic
1027913988 7:84290583-84290605 CACCCACAACTCCCGTGGCATGG + Intronic
1029904288 7:104074642-104074664 CACCTACAATGTTTCTGGCATGG + Intergenic
1031031147 7:116736594-116736616 CAAATAAAACTGTTGTGGCTAGG - Intronic
1031164420 7:118212021-118212043 AACTTACAACAGTTGTTGCAAGG + Intergenic
1035084666 7:156247757-156247779 CACCTCCAGCAGTGGTGGCATGG - Intergenic
1038206437 8:25471055-25471077 CACATATAACTGTTTTGGCTGGG - Intronic
1040578141 8:48672506-48672528 CAGCTACCACATTTGTGGCAGGG + Intergenic
1041331696 8:56733405-56733427 CAGCTACACTTTTTGTGGCAGGG - Intergenic
1045791007 8:105984441-105984463 CACCGAGGTCTGTTGTGGCATGG + Intergenic
1050265464 9:3884878-3884900 CACATAAAAGTGTTGTGTCAGGG + Intronic
1056308922 9:85320493-85320515 CTGCTACAACTCTTGTGCCATGG - Intergenic
1056442690 9:86636504-86636526 CACCCACAACTGTGATGTCAGGG - Intergenic
1057324141 9:94044999-94045021 CACCGAGAACTGTTGTGGGGTGG - Intronic
1192295615 X:69844621-69844643 AACCTAAAACTGTTGAGGGATGG - Intronic
1192756254 X:74049488-74049510 CACCAACAAGTGTTCAGGCAGGG - Intergenic
1198299279 X:135318773-135318795 CAACTAAAACTGATGTGGCGTGG + Intronic
1202021116 Y:20466198-20466220 CACCCACCATTGTTGTGACATGG + Intergenic