ID: 918052716

View in Genome Browser
Species Human (GRCh38)
Location 1:180988584-180988606
Sequence CCACCAAGAGAGATTTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918052712_918052716 8 Left 918052712 1:180988553-180988575 CCAACTTGTGAACAGTCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 58
Right 918052716 1:180988584-180988606 CCACCAAGAGAGATTTACTCTGG 0: 1
1: 0
2: 1
3: 11
4: 99
918052710_918052716 17 Left 918052710 1:180988544-180988566 CCTGCTGATCCAACTTGTGAACA 0: 1
1: 0
2: 1
3: 7
4: 82
Right 918052716 1:180988584-180988606 CCACCAAGAGAGATTTACTCTGG 0: 1
1: 0
2: 1
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918052716 Original CRISPR CCACCAAGAGAGATTTACTC TGG Intronic
903460706 1:23518793-23518815 CCAGGAACAGAGATTTTCTCAGG + Intronic
907652881 1:56312488-56312510 CACACAACAGAGATTTACTCGGG + Intergenic
908243765 1:62211335-62211357 CCACCTTGAGAGAATTACTGGGG + Exonic
911324113 1:96448753-96448775 AAGCCAAGAGAGATTTACTGGGG + Intergenic
916886926 1:169078569-169078591 CCAACAAGAGTGATTTTCTCAGG + Intergenic
917455257 1:175180611-175180633 TCTCCAAAAGAGATCTACTCAGG - Intronic
918052716 1:180988584-180988606 CCACCAAGAGAGATTTACTCTGG + Intronic
918586040 1:186189607-186189629 CCACCAATCAAGATTTAATCCGG + Exonic
920802084 1:209198938-209198960 GCACCAGGACAGATTTTCTCTGG + Intergenic
923114974 1:230927191-230927213 CTACCAGGAGAGATTTATACAGG - Intronic
924291134 1:242537594-242537616 CCACAGACAGAGATTTCCTCTGG - Intergenic
1066171876 10:32857058-32857080 ACACCAAGAGAGATGCCCTCAGG + Intronic
1073651698 10:105367238-105367260 CTACCAAGAGAGACTCCCTCAGG + Intergenic
1074361419 10:112826466-112826488 CCACCCGGAGAGATTTAATCTGG + Intergenic
1074412605 10:113241441-113241463 CCACCAAGAGAGTTTGACCTTGG + Intergenic
1079027156 11:16958511-16958533 CCACAAAGAGTGATTAACTCTGG + Intronic
1080425898 11:32154078-32154100 CCACCAAGAGAGACTCAACCTGG + Intergenic
1085542097 11:77281119-77281141 CAACCAAGACAGCTTTACTGGGG + Intronic
1087320755 11:96655426-96655448 CCACCAAGAGAGATTTGAGGAGG - Intergenic
1089757806 11:120699199-120699221 CCACCAAGAGAGATCAAGGCAGG - Intronic
1095361139 12:41341015-41341037 TCACCAAGGGAGATTTATCCAGG + Intronic
1096015243 12:48266785-48266807 CAAACAAGAGTGATTTCCTCTGG + Intergenic
1097086337 12:56471145-56471167 CCATCATGAGAGAGATACTCTGG - Exonic
1099467201 12:83002099-83002121 CCACCAAAAAAGATTTCCACTGG - Intronic
1102985920 12:117278202-117278224 CCCCCAGGAGACATTTCCTCTGG + Intronic
1109007327 13:56894465-56894487 CCACTGAGAAATATTTACTCTGG - Intergenic
1109222053 13:59650070-59650092 CCACCAATAGAGTCTTACTAAGG + Intergenic
1109802109 13:67394011-67394033 CAAGCAAGAGAGATTCAATCTGG - Intergenic
1112240176 13:97673823-97673845 CCACCCAGAGAGAGTTCCTAGGG - Intergenic
1112602561 13:100870623-100870645 CTACCAAGGGAGATTTACAAAGG - Intergenic
1115857455 14:37646042-37646064 CCACCCAAAGAGATTCACTATGG - Intronic
1115964455 14:38871711-38871733 TCACAAAGAGAGATTTACTGAGG + Intergenic
1118898370 14:69965798-69965820 CCCACAACAGACATTTACTCAGG + Intronic
1202894598 14_KI270722v1_random:193332-193354 TCACCAAGTGGGATTTATTCTGG - Intergenic
1127332511 15:57952743-57952765 CCCCCAAGCGAGATCTGCTCTGG + Intergenic
1127922826 15:63506010-63506032 CCACAAAGAAAAATGTACTCTGG + Intronic
1135485935 16:22864622-22864644 TCACTAAGATAGATATACTCTGG - Intronic
1137606225 16:49788533-49788555 GCAGGAAGAGAGATTTGCTCTGG - Intronic
1139098840 16:63740500-63740522 CCAACAAGTGGGATTTATTCTGG + Intergenic
1139438864 16:66953826-66953848 CCACCCAGGGAGATGTTCTCTGG + Intergenic
1139638000 16:68270479-68270501 CTACCAAGAGCGGTTTTCTCAGG + Intronic
1142053573 16:87976992-87977014 CTACAAAGAGAGATTTACTGGGG - Intronic
1146150285 17:30462775-30462797 CCTCCAACAGAGATTTACCCAGG + Intronic
1146607281 17:34271497-34271519 GAACCAAGAGAGATTCACTTGGG + Intronic
1153295323 18:3540507-3540529 CCCCCAAAAGAGGTTTACTTAGG + Intronic
1165647425 19:37454256-37454278 CCTGCAAGAGAGATTCTCTCTGG - Intronic
929791019 2:45023177-45023199 CAACCAATACACATTTACTCTGG + Intergenic
930436461 2:51350265-51350287 CCACTTGGAGATATTTACTCAGG + Intergenic
932100042 2:68890237-68890259 TCACAAAGAGAGATTTTCACAGG + Intergenic
936698397 2:114979654-114979676 TCACCAAGTGAGATTTACTCAGG + Intronic
938237226 2:129716127-129716149 ACACCAACAGAGATTGTCTCTGG + Intergenic
941458690 2:165740670-165740692 CCAGCAATAGAAATTAACTCTGG - Intergenic
942799832 2:179861822-179861844 CCAAGAAGAGAGTTTCACTCTGG - Intergenic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
947036218 2:225859866-225859888 CAACCAAGAAAGATTTATTTAGG + Intergenic
1172191709 20:33065752-33065774 CCACCCAGAGACATTTATTTTGG + Intronic
1173897326 20:46560953-46560975 CCCCTAAGAGAGACTTTCTCTGG - Intronic
1175501185 20:59452369-59452391 TCAACAAGAGAGATTGTCTCTGG + Intergenic
1176978789 21:15354963-15354985 CAACAAAGAGAGATAGACTCTGG - Intergenic
1184563009 22:45274245-45274267 CCACCACGAGAACTTTCCTCCGG + Intergenic
950883939 3:16346668-16346690 CCCACAACAGAGATTTCCTCAGG - Intronic
955242572 3:57191979-57192001 TCACCAAGTGGGATTTACTTAGG - Intergenic
955312015 3:57898043-57898065 CCACAAAGAGAAATTTCCACAGG - Intronic
965813073 3:172611886-172611908 CAACCAAGTGAGATTTATCCCGG + Intergenic
966275639 3:178163708-178163730 CAACCAAGTGAAATTTATTCAGG + Intergenic
968032704 3:195515124-195515146 CCCCCAAGACAGATTTAAACAGG + Exonic
973607026 4:52598062-52598084 ACACCAAAAGAGATGAACTCTGG - Intronic
976702918 4:87990706-87990728 CCATCAAGGGGGATTTACTCAGG + Intergenic
978844774 4:113260095-113260117 CCACTAAAAGAGATTAATTCAGG - Intronic
979661921 4:123265786-123265808 CCACAGATACAGATTTACTCTGG - Intronic
979771611 4:124532360-124532382 CCAACATAAGAGATTTTCTCTGG + Intergenic
980559575 4:134455376-134455398 CCAACAAGTGAGATTAAGTCAGG - Intergenic
981635592 4:146875130-146875152 CCTGCAAGAGGGATGTACTCTGG + Intronic
988696891 5:33630995-33631017 CCCCCAAGTGTCATTTACTCTGG + Intronic
994375142 5:99010190-99010212 CCACACAGAGAAATTTACTAGGG - Intergenic
994510186 5:100692971-100692993 TTACCAAGACAGATTTACTGTGG + Intergenic
997707857 5:135975451-135975473 CCACCAAGGGAGAGAAACTCAGG + Intergenic
998041964 5:138956272-138956294 CCAGAAAGAAAGATTTCCTCTGG + Intronic
999970267 5:156852927-156852949 CCCCCAAGACAGATTTAAACAGG - Intergenic
1003901042 6:10655858-10655880 ACCACAAGAGAGATTTCCTCTGG + Intergenic
1004005802 6:11636405-11636427 TCACCAAGAGACATTAACTCAGG - Intergenic
1005322026 6:24665007-24665029 CAACCAACAGACATTAACTCAGG + Intronic
1007427972 6:41759479-41759501 CCACCCAGAGAGACCTAGTCTGG - Intergenic
1010496934 6:76545265-76545287 TGACCAAGTGAGATTTACTCCGG - Intergenic
1012703655 6:102494990-102495012 CCTCCAAGAGGGATCTGCTCAGG + Intergenic
1017323633 6:153121370-153121392 CCCCCAAGAGAGTTCTAGTCTGG - Intronic
1018164615 6:161081461-161081483 CCACCAAGACTGATATACGCGGG - Intronic
1021151339 7:17154374-17154396 AGACCAAGTGAGATTTATTCAGG + Intergenic
1021859914 7:24896020-24896042 CTTGCAGGAGAGATTTACTCAGG - Intronic
1023174964 7:37426947-37426969 ACACCGAGAAACATTTACTCAGG + Intronic
1026468201 7:70672509-70672531 CCACCCAAAGAGAGTAACTCTGG - Intronic
1031603641 7:123744064-123744086 CCACCAACAGTGCCTTACTCAGG + Intronic
1036219826 8:6912018-6912040 CCACCAGGAGAGATTAACTGAGG + Intergenic
1039354904 8:36804332-36804354 CCCCCACCCGAGATTTACTCTGG + Intronic
1040318725 8:46278406-46278428 CCATGAACAGAGATTTACCCAGG - Intergenic
1041063399 8:54058563-54058585 CGAGCAAAAGAGATTTATTCTGG - Intronic
1041268981 8:56092257-56092279 TCACCAAGAGCCATTTATTCTGG - Intergenic
1041434793 8:57826935-57826957 CAACAAAAAGAGTTTTACTCTGG + Intergenic
1041961427 8:63621528-63621550 ACACTAAGAGACATTTACTGTGG + Intergenic
1045950824 8:107849843-107849865 CAACCAAGAGAGAAATTCTCTGG + Intergenic
1046092859 8:109524085-109524107 TCACCAAGAGAGATCTGTTCAGG - Intronic
1049245090 8:141558126-141558148 CCATCAAGAGAGCTTTATTGTGG + Intergenic
1049501751 8:142971040-142971062 CCCCCAAGGAAGATTTACTGGGG + Intergenic
1058830958 9:108815955-108815977 CCTCCAAGACAGAATTACTGCGG + Intergenic
1203371857 Un_KI270442v1:314203-314225 CCACTAGGAGAGAGTCACTCAGG + Intergenic
1185530615 X:815508-815530 CTACGAACAGAGAATTACTCTGG + Intergenic
1188387251 X:29576185-29576207 CAACCAAGAGAAATTAAATCAGG + Intronic
1190579295 X:51875283-51875305 CCAAAAAGAGAGAGTTACACAGG - Intronic
1193932162 X:87566740-87566762 CCACCAAGTGGGATTTATTCTGG + Intronic
1197226170 X:123959367-123959389 CCGCCAAGAGCTCTTTACTCGGG - Intergenic
1198109629 X:133491600-133491622 CAAGCAATAGAAATTTACTCTGG + Intergenic
1198665452 X:139017249-139017271 CCAACAACATAGATTTATTCTGG - Intronic