ID: 918058668

View in Genome Browser
Species Human (GRCh38)
Location 1:181044283-181044305
Sequence ATGCTTATAAATGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918058662_918058668 12 Left 918058662 1:181044248-181044270 CCACTGCGCCCGGCCTGATCTTT 0: 3
1: 62
2: 631
3: 3988
4: 15739
Right 918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 289
918058663_918058668 4 Left 918058663 1:181044256-181044278 CCCGGCCTGATCTTTTTTCTTAA 0: 1
1: 3
2: 24
3: 250
4: 1865
Right 918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 289
918058665_918058668 -1 Left 918058665 1:181044261-181044283 CCTGATCTTTTTTCTTAACTATA 0: 1
1: 0
2: 2
3: 41
4: 533
Right 918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 289
918058664_918058668 3 Left 918058664 1:181044257-181044279 CCGGCCTGATCTTTTTTCTTAAC No data
Right 918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918058668 Original CRISPR ATGCTTATAAATGAGGAGGA AGG Intronic
903672974 1:25047287-25047309 ATTCATATGAATGAGGTGGAGGG + Intergenic
907872512 1:58455828-58455850 ATGCTTATAGAGGGAGAGGAAGG - Intronic
908725391 1:67170712-67170734 ATTCTCAAAAATGTGGAGGACGG - Intronic
909815347 1:79985326-79985348 AAGCTTGTAAATAAGGGGGAAGG + Intergenic
909949245 1:81700024-81700046 ATGCAGAGAAATGAGGAAGATGG + Intronic
911189184 1:94930872-94930894 ATTCTTATAGATGTGGAGTATGG + Intergenic
917136607 1:171794160-171794182 GTGCTTTTAAATGTGGAAGAAGG + Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918197944 1:182240193-182240215 ATGTTTATCAATGAGTAGAATGG - Intergenic
918643682 1:186876530-186876552 TTGCCTATAAATTAGGAGTAGGG + Intronic
918923258 1:190744186-190744208 ATGAATATAAATGAGTTGGAAGG - Intergenic
920759690 1:208770725-208770747 ATTCTTATAAAGCAAGAGGATGG - Intergenic
921405244 1:214772013-214772035 AAGCTTATAATTGCGGTGGAAGG + Intergenic
921800056 1:219392365-219392387 ATACAAACAAATGAGGAGGATGG - Intergenic
922757749 1:228105884-228105906 GTGCTTATAACTGAGGAGCCTGG - Intergenic
923167296 1:231378096-231378118 ATACTGAAAAATGAGGAGAAAGG + Intronic
923586889 1:235281119-235281141 ATGCTTTAAAGTGAGCAGGAGGG + Intronic
924591786 1:245410782-245410804 ATGCTTAAAAATGGTGAAGATGG - Intronic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064583219 10:16814901-16814923 ATATTTATAAATGGGGAGAATGG - Intronic
1065502444 10:26395361-26395383 TTGCTTATAACTCTGGAGGATGG - Intergenic
1066326934 10:34369808-34369830 ATGCCTAGAAATGGGGAGGAGGG - Intronic
1067321214 10:45223000-45223022 ATATTTATAAATGGGGAGAATGG - Intergenic
1071698615 10:87904427-87904449 TTTCTTATAAATCAGGAGAATGG + Intronic
1074571409 10:114627697-114627719 AGGCCCATAAATAAGGAGGAAGG + Intronic
1076842096 10:133050678-133050700 ATGCTTTCTGATGAGGAGGAGGG + Intergenic
1080161102 11:29177438-29177460 ATGCTAACAAATGTGAAGGAGGG + Intergenic
1081503982 11:43695698-43695720 AGCCTTTTAAATGATGAGGAAGG + Intronic
1083600263 11:63942946-63942968 ATGCTTAGAAGTGAGATGGAGGG + Intronic
1083989683 11:66239237-66239259 CTGCTCATAGATGGGGAGGAGGG - Exonic
1084071223 11:66736680-66736702 ATACTAATAACTGAGGGGGAAGG + Intergenic
1086531150 11:87786714-87786736 ATGGTGATAAATTGGGAGGAAGG + Intergenic
1087355431 11:97087787-97087809 GTGCTTATAAATGAGGAAAGAGG + Intergenic
1089180084 11:116577560-116577582 ATGCTTAGAGATCAGGAGGCAGG + Intergenic
1090453867 11:126830324-126830346 ATACTTATGAAGCAGGAGGATGG - Intronic
1090796496 11:130140174-130140196 ATGGGTATAATGGAGGAGGAGGG - Intronic
1091390583 12:123843-123865 ATTTTTATAAATGAGGAACAGGG - Intronic
1092310701 12:7348557-7348579 AAGCTTATAAATGAAGAGCCTGG - Intronic
1093087712 12:14885416-14885438 ATCCTTAAAAATGAGGATGCAGG + Intronic
1093504661 12:19851272-19851294 TTGATTCTAAATGAGGATGAAGG - Intergenic
1095163941 12:38949563-38949585 ATGCTTTTAAATGATGGGAATGG + Intergenic
1096452970 12:51760191-51760213 ATGCTTCTCAAAGAGGAGAAAGG - Intronic
1097642338 12:62197296-62197318 CTGCTTAGACTTGAGGAGGATGG - Intronic
1097716493 12:62971863-62971885 ATGCTTTTCCATGAGGAGCAAGG + Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1098621861 12:72610974-72610996 AGGCTATCAAATGAGGAGGAAGG + Intronic
1100011806 12:89962570-89962592 ATCCTTATATATGAGGTGGGAGG - Intergenic
1100460315 12:94793068-94793090 GTTCTTATAAATGAGTGGGAGGG - Intergenic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1104561888 12:129853261-129853283 ATGTTTCTAGATGAGGAGAATGG + Intronic
1107259933 13:38477971-38477993 ATGTTTATACATGAGGGTGAAGG - Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107645487 13:42490707-42490729 ATGCTTAAAAATGATTAAGATGG + Intergenic
1108292010 13:48971384-48971406 ATCCTTGGAAATGTGGAGGAAGG + Intergenic
1108730727 13:53232742-53232764 ATGATTAAAAATGAGGAAGGAGG + Intergenic
1109557908 13:64004624-64004646 ATTTTTGTATATGAGGAGGAAGG + Intergenic
1110341383 13:74395161-74395183 ATGCTTATAAATGATTTGGCTGG + Intergenic
1110594982 13:77310235-77310257 GTGCATAAAAATGAGGAGGTAGG - Intronic
1112996535 13:105581023-105581045 TTGCTTATAATTGTTGAGGAAGG - Intergenic
1113077168 13:106478325-106478347 ACTTTTCTAAATGAGGAGGAGGG - Intergenic
1113701535 13:112392432-112392454 TTGCTTATGAAGGAGGAGAAAGG + Intronic
1114261551 14:21040399-21040421 ATGATTCTAAGTCAGGAGGATGG - Intronic
1114559447 14:23579523-23579545 TTGCTTCTGAATGGGGAGGAGGG + Intergenic
1114812942 14:25921693-25921715 GTGGTTACAAATGGGGAGGATGG + Intergenic
1115043570 14:28961007-28961029 TTGCTTATAGATGAGGAAAATGG - Intergenic
1115405956 14:33016773-33016795 ATGCTTAAAAATTAGGAAGGAGG - Intronic
1115872807 14:37824226-37824248 TTGTTTGTAAGTGAGGAGGAAGG - Intronic
1116536294 14:46035276-46035298 CTGTTTATAAATGAGGAGACAGG - Intergenic
1117033478 14:51701749-51701771 ATGCTTTTAAATGAAAAGTATGG + Intronic
1117279768 14:54227563-54227585 ACACTTATGACTGAGGAGGAAGG - Intergenic
1117312686 14:54543853-54543875 ATGCTTAAAAGTGAGTAAGATGG - Intergenic
1118635224 14:67742738-67742760 ATGTTTTCAAATGAGGAGGTGGG + Intronic
1120434420 14:84462856-84462878 ATGCTTGTAAGGGAGGAAGATGG - Intergenic
1121906875 14:97753978-97754000 ATGCTTATGAATGATTAAGATGG - Intronic
1125241317 15:37580573-37580595 ATGCTTCTAATTTAGGAGAATGG - Intergenic
1125738648 15:41945947-41945969 CTGCTTATAAAGGAGGAGACTGG - Intronic
1126136015 15:45392260-45392282 AAGCTTAGAAATGAGGAAGAAGG + Intronic
1126206504 15:46051295-46051317 ATTCTAAAAATTGAGGAGGAAGG - Intergenic
1127689570 15:61381885-61381907 ATGCTAATAAATCAAGAGGAGGG - Intergenic
1130542315 15:84829547-84829569 ATGATTATTCATGAGGAGGTAGG + Intronic
1131227060 15:90633063-90633085 ATTATAATAAATGAGGAGGGTGG - Intronic
1131621330 15:94071161-94071183 ATGGAAATAAATGAGGATGAAGG + Intergenic
1131856008 15:96595492-96595514 ATCCTAAAAAATGAAGAGGATGG + Intergenic
1134230019 16:12421720-12421742 ATGCTTCTGATTGAGGAGGAAGG - Intronic
1134765955 16:16758142-16758164 CTGCTGATAACTGGGGAGGAGGG - Intergenic
1134980093 16:18601072-18601094 CTGCTGATAACTGGGGAGGAGGG + Intergenic
1135476537 16:22781160-22781182 ATGCTTACATCTGAGGCGGAAGG + Intergenic
1137990232 16:53146499-53146521 ATACTTAAAAATGGTGAGGATGG + Intronic
1139245792 16:65442285-65442307 ATGCTTATAAACCAGGTGGTAGG - Intergenic
1139812233 16:69630469-69630491 ATTCTTAAAAATGAGGAGGAGGG - Intronic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140195909 16:72855213-72855235 ATGGTTATAATTGATGAGGTTGG - Intronic
1141261175 16:82455016-82455038 GTGCTTATAACTGAACAGGATGG + Intergenic
1141291204 16:82719524-82719546 ATGCTTAAAACAGAGGGGGAAGG - Intronic
1143924351 17:10356674-10356696 ATGGTTATCAATGAGGAAGTAGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146635704 17:34502842-34502864 ATGCTGATGAAAGGGGAGGAGGG - Intergenic
1150526685 17:65931153-65931175 ATTCTTAAGGATGAGGAGGAGGG + Intronic
1150932796 17:69603554-69603576 ATGCTGGTAGATGTGGAGGATGG + Intergenic
1151152295 17:72098489-72098511 ATGGTTAGAAATGAAGAGCAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153699396 18:7677672-7677694 ATGCCCATAAGTGAGTAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1153877021 18:9383032-9383054 ATGTTTGTAAATAAGGAGAAGGG + Intronic
1154228466 18:12530614-12530636 ATCTTTAAAAATGGGGAGGAAGG - Intronic
1154326243 18:13392874-13392896 TCGCTCATAAAGGAGGAGGAGGG + Intronic
1154389849 18:13927138-13927160 AAGGTTAAAAATGAGAAGGATGG + Intergenic
1155946934 18:31863772-31863794 AGGCTTATACCTGAGGAGCAGGG - Intronic
1156229814 18:35142519-35142541 ATGTTTATAACTGAGAAGGCTGG - Exonic
1157100775 18:44727341-44727363 ATGCTTTCAAATGAGAAGGAAGG - Intronic
1159069445 18:63606818-63606840 ATGCTTACAAATGAGGACTCTGG + Intergenic
1160395952 18:78572402-78572424 ATGGTTACAGGTGAGGAGGACGG + Intergenic
1164389749 19:27807526-27807548 ATTCTGAAAAATAAGGAGGAGGG + Intergenic
1164836201 19:31356697-31356719 AGTCTTATAAAGGTGGAGGAGGG - Intergenic
1165706005 19:37976636-37976658 ATGCTTATGAATAAGGAGTGAGG - Intronic
1166587556 19:43963760-43963782 TTGATTATAAATGAGCAGAATGG - Intronic
1168074735 19:53974003-53974025 ATACTTAAAAATGATGAAGATGG - Intronic
1168537363 19:57182182-57182204 ATGATTATTCATGAGGAGGTGGG - Intergenic
925074303 2:1000722-1000744 ATTTTAAAAAATGAGGAGGAAGG + Intronic
925494111 2:4426677-4426699 ATGGTTCTAAATGGGGAGGCAGG - Intergenic
925764897 2:7223039-7223061 ATTCTCATAAATGATGGGGATGG + Intergenic
927263275 2:21116567-21116589 TTGGTTAGAAGTGAGGAGGAGGG + Intergenic
927518087 2:23683503-23683525 AGGCTTAGAAAGGAGAAGGAGGG - Intronic
930714591 2:54581314-54581336 TTGCTTAGAATTGAGGAGGAGGG + Intronic
930715691 2:54592276-54592298 ATGCTTCTAGAAGAGGATGATGG + Intronic
934887466 2:98037602-98037624 ATGCTTATAAAGAAGGAAAAAGG + Intergenic
934948326 2:98558267-98558289 GAGCTTATGAATGAGGAGGAAGG - Intronic
935043389 2:99456384-99456406 GTGCAAATAAATGAAGAGGAAGG + Intronic
938634242 2:133205566-133205588 ATGATTATAAATGAAGATAATGG - Intronic
939569558 2:143824589-143824611 CTGCTTATAAATGAGCAAGGGGG + Intergenic
940325235 2:152418315-152418337 ATGCTTAAAAATGGCAAGGATGG - Intronic
941417584 2:165241357-165241379 ATGCTCATGAATGATGTGGATGG + Intronic
942829030 2:180216720-180216742 ATTCCCATAATTGAGGAGGAGGG + Intergenic
943266921 2:185743207-185743229 ATGCTTTTAAATGTGGATCATGG - Exonic
943737719 2:191375393-191375415 AAGCTTATAATTGAAGAGGAAGG + Intronic
944947325 2:204704107-204704129 ATACTTAGAAATGATGAAGATGG - Intronic
946936954 2:224732269-224732291 ATGCTTATAAATTAAGAAAATGG + Intergenic
948265322 2:236631797-236631819 GGACTTACAAATGAGGAGGATGG + Intergenic
948392917 2:237625706-237625728 AGGCTTAAAGATGAGGAAGATGG + Intergenic
1169475951 20:5931321-5931343 AGGCTTATAAATGAGGATTATGG + Intergenic
1169837690 20:9898732-9898754 AAGTTTATAGATGAAGAGGAAGG + Intergenic
1171394807 20:24825155-24825177 ATCCTTATAAAAGAGGCTGAGGG - Intergenic
1172927030 20:38547165-38547187 TGGCTTATAACTGAGGGGGAGGG - Intronic
1174117078 20:48233779-48233801 ATGGTGAGAAGTGAGGAGGAAGG + Intergenic
1174404743 20:50295965-50295987 AGACTTATAAAGGACGAGGAAGG - Intergenic
1175433307 20:58923048-58923070 ATGCTTATAGTTGTGGATGAAGG - Intergenic
1175614853 20:60389288-60389310 AGGCTTCTGAATGAGCAGGAAGG + Intergenic
1176337009 21:5608535-5608557 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176390748 21:6212413-6212435 ATTATTATTAATAAGGAGGAGGG + Intergenic
1176470671 21:7103761-7103783 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176494232 21:7485539-7485561 ATTATTATTAATAAGGAGGAGGG - Intergenic
1176506410 21:7652844-7652866 ATTATTATTAATAAGGAGGAGGG + Intergenic
1177628931 21:23701540-23701562 ATACTTGTAAAAGAGGAAGAGGG - Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
949237541 3:1828251-1828273 GTCCATATAAATAAGGAGGATGG - Intergenic
950473376 3:13200288-13200310 CTGCTTATAAATGATAAGGGGGG - Intergenic
951189940 3:19756305-19756327 ATGCTTATAGATCTGGTGGAAGG + Intergenic
951307835 3:21087283-21087305 AAGCTTATAATCGTGGAGGAAGG + Intergenic
951799444 3:26578893-26578915 ATGAATATAAATGGGGAAGAGGG - Intergenic
952782883 3:37120946-37120968 ATTGTTATAAGTCAGGAGGAAGG - Intronic
952839412 3:37631512-37631534 ATGATTATAAATGAGTAGATCGG + Intronic
953563246 3:44011293-44011315 ATGCATACAAGTGAGGAGGGTGG - Intergenic
954361101 3:50123258-50123280 ATGCTTATGAGTGCAGAGGATGG - Intergenic
957197812 3:77093067-77093089 ATGTTTTTAAAAGAAGAGGAGGG - Intronic
958088600 3:88846760-88846782 ATGCCTATAAATAAGGAAGCAGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959611443 3:108299659-108299681 TTGCTGATAAGAGAGGAGGAAGG + Intronic
960427846 3:117531061-117531083 ATAAATATAAATGAAGAGGAGGG - Intergenic
961578626 3:127859310-127859332 ATGATTATATCTGGGGAGGAGGG + Intergenic
961790109 3:129369489-129369511 CTGCTTATAAATGATAAGGGGGG + Intergenic
961912046 3:130327823-130327845 ATGTTTATAAATAAGCAGAATGG + Intergenic
963348100 3:144120220-144120242 TTGCTTATCAATGTGGAGGTGGG - Intergenic
963988783 3:151629048-151629070 ATGCTCATAAAGGAGGAAGATGG - Intergenic
964834585 3:160923685-160923707 TTGCTTTTAAATGAGTAGTAAGG + Intronic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
966811948 3:183854697-183854719 ATGCTTAAAAATGATTAAGATGG + Intronic
967411910 3:189174796-189174818 ATGCCTATAAAAGAATAGGAAGG + Intronic
967979313 3:195056050-195056072 AAGCTTAAAAGTGAGGAGGAGGG - Intergenic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970915244 4:21325139-21325161 ATTCTGAAAAATTAGGAGGAGGG - Intronic
970947541 4:21712832-21712854 ATGCTTAGAAATAAAAAGGAGGG - Intronic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971887662 4:32473785-32473807 ATGCTGATAAGGGAGGGGGAAGG - Intergenic
972631603 4:40846804-40846826 CTGCTTACTAATGAGGAGGAGGG + Intronic
974718003 4:65696063-65696085 AAGCTTATGACAGAGGAGGAAGG - Intergenic
975995314 4:80307273-80307295 ATGCTTAGAAATGAAGTGGATGG - Intronic
976457945 4:85271346-85271368 ATGCCAAAAATTGAGGAGGAAGG + Intergenic
977464099 4:97361564-97361586 ATTCTTATAAATAATAAGGAAGG - Intronic
978072383 4:104490407-104490429 ACCCTTTTTAATGAGGAGGAGGG + Intronic
978936391 4:114382518-114382540 ATGCTTATCAAAGAGGTGGTAGG - Intergenic
978976008 4:114873959-114873981 ATACTTAGAAATGATGAAGATGG - Intronic
979328165 4:119403115-119403137 ATGGTCATCCATGAGGAGGAGGG + Intergenic
979563395 4:122125690-122125712 ATGCTAAGAACTGAGGAGTAAGG - Intergenic
979970781 4:127132267-127132289 ATGATTATAAATAAGGCTGATGG + Intergenic
980193213 4:129552211-129552233 ATGCCTAAAAATGATTAGGATGG + Intergenic
980330880 4:131409385-131409407 ATGCTTTTAGATGTGGAAGATGG - Intergenic
981245953 4:142538183-142538205 ATGCTTACAAAGAAGGAGTATGG - Intronic
981744704 4:148041196-148041218 ATGTTTAAGAATGAGGAGCATGG + Intronic
984928040 4:184824098-184824120 ATGCTTATAATTGTGGGGAAGGG + Intronic
987000483 5:13655167-13655189 ATGCTGAGAAATGAGGAAGGTGG + Intergenic
987483765 5:18495824-18495846 GTACTTAGAAATGAGGAGCATGG - Intergenic
987670734 5:21003978-21004000 AGGTTAACAAATGAGGAGGATGG + Intergenic
988914445 5:35878287-35878309 ATGCCTATCAAGGAGGTGGAAGG - Exonic
989469216 5:41795439-41795461 CTACTTAGGAATGAGGAGGAAGG + Intronic
990206175 5:53431911-53431933 ATGCTTATGAATCAGGAGGCAGG + Intergenic
991389071 5:66123045-66123067 ATGCATATAACTGAAGAGGCTGG + Intergenic
991505816 5:67322945-67322967 ATATTTTGAAATGAGGAGGAAGG - Intergenic
992005888 5:72476857-72476879 AAGCTTAACAATGAGGAAGAGGG + Intronic
992090528 5:73312274-73312296 AGGCATAAAAATGAGGAGCAAGG - Intergenic
992501102 5:77345013-77345035 GTGCTGATACATGAGGATGATGG - Intronic
992697514 5:79304847-79304869 TTGCTTATAAATGAGGATACAGG - Intronic
993098841 5:83511613-83511635 GTAGTTATAAATGAGAAGGAAGG + Intronic
993760639 5:91792562-91792584 ATGTTTATGTATGAGGAGAAGGG - Intergenic
993827749 5:92713293-92713315 TTGCTAATAAATTAGGAGGAGGG + Intergenic
994009152 5:94879463-94879485 ATGATTATCAATTAGGAGGAGGG - Intronic
994852614 5:105075257-105075279 GTGCTTAGAAATGTGGAGAAGGG - Intergenic
995061720 5:107818015-107818037 ATGCTTAAAAATGATTAAGATGG - Intergenic
995944296 5:117624288-117624310 ATGATAATAAATGAGCAGAAAGG - Intergenic
996001772 5:118372751-118372773 ATTCTTCTTAATGAGGAGGGAGG - Intergenic
996286449 5:121798710-121798732 GTATTAATAAATGAGGAGGAAGG + Intergenic
996916009 5:128713095-128713117 ATGCTCTTAGATGAGGTGGAAGG - Intronic
997270768 5:132535870-132535892 AAACTTATAAATTTGGAGGACGG + Intergenic
997475067 5:134138039-134138061 GTGCTGAAAAATGAGAAGGAGGG - Exonic
997698987 5:135883186-135883208 ATGCTTGTAATTGTGAAGGAAGG - Intronic
998720109 5:144935857-144935879 ATACTTAGAAATAAGGAGGTAGG + Intergenic
998772281 5:145559611-145559633 TTTCTTAGAAATAAGGAGGAGGG - Intronic
999224157 5:150006298-150006320 ATGCTTAGAAATGAGAAGCTAGG + Intronic
999985217 5:156997386-156997408 ATCCTTATTCATGAGGATGAGGG + Intergenic
1000475109 5:161697275-161697297 ATGCTTACAATAGAGCAGGAAGG + Intronic
1001653566 5:173331404-173331426 ATGCGTTAAATTGAGGAGGAGGG - Intergenic
1004158154 6:13189339-13189361 ATGGTTATAAATGAGGATTCTGG - Intronic
1005631697 6:27714098-27714120 CAGCTTATAAAGGATGAGGATGG + Intergenic
1006877510 6:37311367-37311389 ATGCTTAGAAATGAAAAGGCTGG + Intronic
1007541908 6:42654157-42654179 ATGCTTATAGATAAATAGGAGGG - Intronic
1007574021 6:42913218-42913240 ATGCTTACAAATGGTTAGGATGG + Intergenic
1007671013 6:43553870-43553892 AAGATTATAAAGGGGGAGGAGGG - Intronic
1007733619 6:43966726-43966748 ATGCTTTTAAACCAGGAGGGAGG + Intergenic
1012193872 6:96315586-96315608 ATGCTTATAAGTGAAGAAGGAGG + Intergenic
1013006774 6:106081277-106081299 GGACTTAAAAATGAGGAGGAGGG - Intergenic
1014321795 6:119939156-119939178 ATTCTAAAAATTGAGGAGGAAGG - Intergenic
1016340306 6:143054853-143054875 ACTCTTACAGATGAGGAGGAGGG + Intergenic
1016788412 6:148039751-148039773 ATTCTTATAAATGCATAGGATGG + Intergenic
1017528090 6:155260468-155260490 ATCCTTGTAAAACAGGAGGATGG + Intronic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1018026382 6:159809592-159809614 CTAGTTATAAATGAGAAGGAAGG - Intronic
1018063065 6:160105332-160105354 ATGCTTTTAAATGAGGACTTGGG - Exonic
1019703204 7:2484451-2484473 ATGTTTATGGATGAGGAGTAAGG - Intergenic
1019896271 7:3985776-3985798 ATGCTTATAAATGGTGCGTATGG + Intronic
1020152210 7:5691316-5691338 CTGCTTATAACTGAGAAGTAAGG - Intronic
1021038456 7:15830565-15830587 CTACTTATAAATGATGAAGATGG + Intergenic
1021329408 7:19317171-19317193 ACACTTATAAGTGTGGAGGAGGG - Intergenic
1022311567 7:29200973-29200995 TTAATTATAAATGAGGAGAAAGG - Intronic
1023401930 7:39797114-39797136 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1024075907 7:45817744-45817766 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1024647691 7:51383548-51383570 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025051527 7:55738040-55738062 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025128490 7:56363707-56363729 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025176872 7:56806585-56806607 ATGGTCATCCATGAGGAGGAGGG + Intergenic
1025228260 7:57181873-57181895 ACGCCTGTAAAGGAGGAGGAGGG - Intergenic
1025694921 7:63769801-63769823 ATGGTCATCCATGAGGAGGAGGG - Intergenic
1028161322 7:87488770-87488792 ATCCTGAAAAATAAGGAGGAGGG + Intergenic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1033676767 7:143548732-143548754 ATGTTTATAAATGACTAGGAAGG + Intergenic
1033695068 7:143780703-143780725 ATGTTTATAAATGACTAGGAAGG - Intergenic
1034926097 7:155123382-155123404 ATGTTTTTAAAAGAGGAGAAAGG - Intergenic
1035632319 8:1117464-1117486 ATGCTTAGAAATGAGGACTGAGG + Intergenic
1039098146 8:33909240-33909262 ATTCCTAAAAATGAGGAAGAAGG + Intergenic
1040084624 8:43326588-43326610 ATGCTTATAAATAAAGACCAAGG - Intergenic
1040961227 8:53035535-53035557 ATGCATATAGGTGAGGAGAAGGG + Intergenic
1041542601 8:59002928-59002950 ATGCTTATAAATGCTGGTGAAGG + Intronic
1043267432 8:78284322-78284344 ATGGTTATAGATGAGGAGATTGG - Intergenic
1045230198 8:100298416-100298438 CTACTTATAAATGAGGGAGATGG + Intronic
1046699713 8:117386388-117386410 ATGCTTATTAACAAGGAGAAGGG - Intergenic
1046895472 8:119467115-119467137 ATTCCAAAAAATGAGGAGGAGGG + Intergenic
1048982151 8:139708370-139708392 ATCCTAAAAGATGAGGAGGAGGG - Intergenic
1049023399 8:139972830-139972852 ATGCTTATAGATGAGGCAGACGG + Intronic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1051050336 9:12924876-12924898 ATGCTTATAAATGGAGATAAAGG + Intergenic
1051883857 9:21869376-21869398 AAACTTATCAAAGAGGAGGAAGG - Intronic
1052807075 9:33023126-33023148 ATGCTAATAAAGGAAGAGTAGGG - Intronic
1055172197 9:73272455-73272477 ATGCTAACACATGAGAAGGAAGG - Intergenic
1056148590 9:83761519-83761541 ATTCTGACAAAAGAGGAGGAGGG + Intronic
1056284200 9:85071395-85071417 ATGCTTATAAGAGAGAAGCAGGG + Intergenic
1057984870 9:99702760-99702782 ACCCTTTTAAATGAGGAGGGAGG - Intergenic
1058151679 9:101470504-101470526 AAGTTTATAAAAGAGGAGGCAGG - Intergenic
1058244882 9:102610599-102610621 ATGCTTATAAATGTGTTGGTTGG - Intergenic
1058840453 9:108902470-108902492 ATGCCTATAATTGTGGTGGATGG - Intronic
1060864078 9:126981089-126981111 GTGCTTATTAATGAGGAGATGGG + Intronic
1061115662 9:128609778-128609800 ATGATTAGAAATGAAAAGGATGG - Intronic
1203424644 Un_GL000195v1:26371-26393 ATTATTATTAATAAGGAGGAGGG + Intergenic
1187592944 X:20739042-20739064 ATGATTTTAAACGAGGAGGAAGG - Intergenic
1188787204 X:34362041-34362063 ATGGTAATAGATGAGGAAGATGG + Intergenic
1188919726 X:35958037-35958059 AGGCTGATGAATGAGGAGAAGGG - Intronic
1190132203 X:47758954-47758976 ATGCATCTATATTAGGAGGATGG + Intergenic
1190211779 X:48454518-48454540 GTCCTTATAAATGAGATGGAGGG + Intergenic
1190541230 X:51480825-51480847 ATTCATATAAATGAGGACAAGGG + Intergenic
1192364597 X:70460741-70460763 TTGCTTAGACATGAGGGGGATGG - Intronic
1192633712 X:72797623-72797645 AAGCAAATAAATGAAGAGGAGGG - Intronic
1192647998 X:72923178-72923200 AAGCAAATAAATGAAGAGGAGGG + Intronic
1194423507 X:93707271-93707293 CTGCCTATAAATAAAGAGGAAGG + Intronic
1194532025 X:95061531-95061553 CTGATGATAAATGAGAAGGATGG + Intergenic
1196432877 X:115645890-115645912 ATACTTATAAATGAATGGGATGG + Intronic
1196657679 X:118236190-118236212 ATGCTTAAAAATGATTAAGAAGG - Intergenic
1197374647 X:125667169-125667191 ATTCCAAAAAATGAGGAGGATGG + Intergenic
1198004836 X:132482432-132482454 ACCCATCTAAATGAGGAGGAAGG - Intronic
1198154401 X:133944760-133944782 ATGCTTATAAATGCACAAGAGGG + Intronic
1198601174 X:138285710-138285732 ATGCTGATAGAAGAGGAGTAAGG - Intergenic
1199388745 X:147254888-147254910 AGGCTTGAAAACGAGGAGGAGGG + Intergenic
1199769965 X:150969060-150969082 GTGCTTAGAAATAAAGAGGAGGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic