ID: 918061697

View in Genome Browser
Species Human (GRCh38)
Location 1:181067043-181067065
Sequence AACATTTATGTCAAGACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918061697_918061698 -3 Left 918061697 1:181067043-181067065 CCTCATGTCTTGACATAAATGTT No data
Right 918061698 1:181067063-181067085 GTTCAACATCTCTAGTCATTAGG No data
918061697_918061699 -2 Left 918061697 1:181067043-181067065 CCTCATGTCTTGACATAAATGTT No data
Right 918061699 1:181067064-181067086 TTCAACATCTCTAGTCATTAGGG 0: 2
1: 20
2: 246
3: 1318
4: 3573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918061697 Original CRISPR AACATTTATGTCAAGACATG AGG (reversed) Intergenic
No off target data available for this crispr