ID: 918064220

View in Genome Browser
Species Human (GRCh38)
Location 1:181088869-181088891
Sequence GCACAGGGCCGTCGGCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918064220_918064228 -8 Left 918064220 1:181088869-181088891 CCCCGGCGCCGACGGCCCTGTGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 918064228 1:181088884-181088906 CCCTGTGCAGGGGAAGCAGATGG 0: 1
1: 1
2: 3
3: 43
4: 437
918064220_918064230 4 Left 918064220 1:181088869-181088891 CCCCGGCGCCGACGGCCCTGTGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 918064230 1:181088896-181088918 GAAGCAGATGGAGTTCAAGCTGG 0: 1
1: 0
2: 0
3: 26
4: 211
918064220_918064231 7 Left 918064220 1:181088869-181088891 CCCCGGCGCCGACGGCCCTGTGC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 918064231 1:181088899-181088921 GCAGATGGAGTTCAAGCTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918064220 Original CRISPR GCACAGGGCCGTCGGCGCCG GGG (reversed) Exonic
900179849 1:1306283-1306305 GTACAGGGCCGTCTGCGTGGAGG + Intronic
900298382 1:1964343-1964365 GCACAGGGCTTTCGGGGCCACGG + Intronic
901279962 1:8026294-8026316 GCACCGGACCGCCGTCGCCGCGG + Exonic
903822215 1:26111507-26111529 GCTCAGGGCCCGCGGCCCCGGGG - Intronic
906532775 1:46533051-46533073 GCAGACGGCCGCGGGCGCCGGGG + Intergenic
906680937 1:47725149-47725171 GCGCATGGCCGGCCGCGCCGGGG + Intergenic
915238307 1:154501940-154501962 GCCCAGGAGCGTCGGGGCCGTGG + Exonic
918064220 1:181088869-181088891 GCACAGGGCCGTCGGCGCCGGGG - Exonic
1062842851 10:684631-684653 GCACAGGGCTGGGGGTGCCGAGG + Intronic
1065868396 10:29934231-29934253 GCACACGGCTGTCGCCCCCGTGG + Intergenic
1067110634 10:43397193-43397215 GGACTGGCCCGTCGGCCCCGAGG + Intronic
1068523815 10:58105944-58105966 CCACAGAGCCGTAGGCACCGTGG - Intergenic
1068671354 10:59726811-59726833 GCACCGGGCTGTCTGCCCCGTGG + Intronic
1070305028 10:75234778-75234800 CCTCAGGGCCGCCGGGGCCGCGG - Intronic
1072336618 10:94403315-94403337 GCAGCGGGGAGTCGGCGCCGGGG + Exonic
1073099595 10:100999775-100999797 GGCCAGGGCCGGGGGCGCCGCGG + Exonic
1075885538 10:125896345-125896367 GCACAGGTCCTGCGGGGCCGCGG + Intronic
1076667128 10:132099763-132099785 GCACAGGGCAGGCGGTGCCCAGG - Intergenic
1077074633 11:694804-694826 GCACATGGACATGGGCGCCGAGG - Exonic
1081804942 11:45885509-45885531 GCCCAGGGCCGCGGGGGCCGTGG + Intergenic
1083572914 11:63769431-63769453 GCAGAGAGCCGGCTGCGCCGGGG + Intergenic
1093894822 12:24563347-24563369 GCACAGTGCCGGCGGCGGCGGGG - Intergenic
1096106332 12:48998616-48998638 GCCCAGGGCCGGCGGGGCGGCGG + Exonic
1102240225 12:111320484-111320506 GCACAGGGGCCTCGTCCCCGCGG - Exonic
1102247177 12:111362889-111362911 GCACTGGGCCGGCGGGGCAGGGG + Exonic
1105004167 12:132710821-132710843 GCGGAGCGCCGTCGGGGCCGTGG + Exonic
1105070649 12:133232467-133232489 GCACAGAGCCGTCGGCTCTGAGG - Intronic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1114316060 14:21511096-21511118 GCACTGGGCTGTTGGGGCCGAGG - Intronic
1119500870 14:75126672-75126694 AGACAGGGCGGCCGGCGCCGAGG + Intronic
1122629119 14:103099328-103099350 CCCCAGGGCCCTCGGCACCGTGG - Intergenic
1202872528 14_GL000225v1_random:177595-177617 GCACAGGTCCTGCGGGGCCGCGG - Intergenic
1124970949 15:34489617-34489639 GCACAGGGCTGTCGGCGTGAGGG + Intergenic
1125664218 15:41417349-41417371 CCAGAGGGCTGTCGGGGCCGCGG + Intronic
1128768617 15:70265990-70266012 CCACAGGTCCGTGGGCCCCGTGG - Intergenic
1132656566 16:1044045-1044067 GCCCTGGGCCGGCGGCGGCGGGG + Intergenic
1132728377 16:1348620-1348642 GGCCAGGGCGGTAGGCGCCGCGG - Exonic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1141682617 16:85553365-85553387 ACAAAGGGCCGCCGGCGCCGAGG + Intergenic
1142352053 16:89585018-89585040 GCGCAGGGCCCTGGGGGCCGTGG + Intronic
1142696187 17:1635135-1635157 GGACAGGGCCTTCGGATCCGCGG + Exonic
1143443867 17:6996039-6996061 GCCCAGGGCTGCCGGCGCCTCGG - Intronic
1143676388 17:8436082-8436104 GCGCTGGGCCGGCGGCGCCGAGG + Intronic
1146208231 17:30922529-30922551 GCACAGGACTGTCGGCGGCCTGG - Intronic
1149431305 17:56596865-56596887 GGACAGGGCGGGCGGGGCCGGGG - Intergenic
1150216841 17:63476026-63476048 GCAGAGGCCCGGCGGCGCAGTGG - Intergenic
1151691432 17:75688446-75688468 GCACAGGGCAGCCAGCCCCGAGG - Intronic
1152395469 17:80030362-80030384 TCACAGGGACGTCGGGGCCCAGG - Intronic
1152754667 17:82082257-82082279 GCTCAGGGCCGTGGGAGCCAAGG - Intronic
1160500150 18:79397469-79397491 GCACAGGGCCGTGAGCTCCACGG + Intronic
1160539243 18:79611482-79611504 GCACAGGGGCGTGGGGGCAGCGG - Intergenic
1160845306 19:1163687-1163709 GCACAGGCCAGGCGGCGCCGGGG + Intronic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1161461522 19:4400419-4400441 GCAGAGGGTCGGCGGCGCCCGGG - Exonic
1162830850 19:13283290-13283312 GCACAGGGTCCTCGGCGGCCAGG + Exonic
1165849296 19:38840179-38840201 GCACAGGGCTGTCGGCGTGAGGG + Exonic
1168343812 19:55641059-55641081 GCTCCGGGCCGGCGGCGCCGGGG - Intronic
926101858 2:10122975-10122997 GCTCAGGGCCGGCGGCTGCGGGG - Exonic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
934608548 2:95717084-95717106 ACACAGGGCCGTCAGCTCTGAGG - Intergenic
937221884 2:120346581-120346603 GCTCCTGGCCGTCGGCGCCCGGG - Exonic
938451585 2:131425467-131425489 GGACAGGGCCGAGGGCGCCCGGG - Intergenic
940830108 2:158457161-158457183 GATCAGGGACATCGGCGCCGAGG - Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
948830068 2:240594355-240594377 GCACAGGGCCTTCTGGGCAGCGG - Intronic
1172661739 20:36573465-36573487 GGGGCGGGCCGTCGGCGCCGAGG - Intergenic
1175760646 20:61560515-61560537 GCCCAGGGCCGTCTGAGCTGTGG - Intronic
1175847474 20:62066118-62066140 GCTCAGGGGCGCGGGCGCCGGGG + Intergenic
1179615314 21:42579672-42579694 GCACAGGGCGGCCCGCGCCGTGG - Intronic
1180064356 21:45405203-45405225 CCCCAGGACCGTCAGCGCCGCGG - Intronic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1184074657 22:42168656-42168678 GCACAGAGCAGTCGGAGCGGGGG - Exonic
1185122648 22:48981744-48981766 GCACAGGGCAGTGGGGGACGTGG + Intergenic
1185278753 22:49961037-49961059 GCGCGGGGCCGGCGGGGCCGGGG + Intronic
1185398616 22:50604777-50604799 GCACGGGCCCCTCGGCGCCGCGG + Exonic
950445494 3:13035116-13035138 GCACAGGGCCATGGGCTCCCAGG + Intronic
954330147 3:49885525-49885547 GCACAGAGCTGTGGGCTCCGAGG + Intergenic
954879403 3:53823447-53823469 GCAGCGGGCCATCGGCGCCCCGG + Exonic
956678105 3:71753948-71753970 GCCCAGGGCCGGCGGAGCGGCGG + Intronic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
964358429 3:155870860-155870882 GCACAGAGCCATCGGGGCCAGGG - Exonic
968480541 4:831146-831168 TCACAGGGCAGTGGGCGCCAAGG + Intergenic
982056851 4:151559413-151559435 GCACAGGGCAGTGGGGGCTGGGG - Intronic
985682975 5:1266102-1266124 GCACAGGGCCTGCAGGGCCGAGG - Intronic
987247323 5:16061679-16061701 GCACAGGGGCTTTGGGGCCGTGG - Intergenic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1002540445 5:179902994-179903016 GCACAGGGCGGGCGGCACCCCGG - Intronic
1008030498 6:46688572-46688594 GCACTGGCCCGCCGACGCCGTGG + Exonic
1011983932 6:93419037-93419059 GCACAGGGCTGTAGGCGGCTCGG + Intronic
1019577956 7:1746573-1746595 GCACAAGGCCGCGGCCGCCGAGG + Exonic
1019640198 7:2099253-2099275 GCACAGGGCAGGCGGGGCTGTGG - Intronic
1019663909 7:2241944-2241966 GGGCAGGGCCGGCGGGGCCGTGG - Intronic
1019667124 7:2257506-2257528 GCACAGGTCCTGCGGGGCCGGGG + Exonic
1020288817 7:6706743-6706765 CCCCAGCGCCGTCGGCTCCGGGG + Exonic
1021958892 7:25852911-25852933 GCACAGGGCGGCGGGCGCAGGGG - Intergenic
1027054725 7:75042341-75042363 GCTCGGGGCCCTCGGCGCAGAGG + Exonic
1027232663 7:76281737-76281759 GCCCGGGGCCGGGGGCGCCGCGG - Exonic
1035266103 7:157691011-157691033 GCACCCGGCCGGCGGCGGCGCGG + Intronic
1038447620 8:27614853-27614875 GCACCGGGCTGGGGGCGCCGGGG + Exonic
1038613202 8:29071980-29072002 GCCCACGGCCGTCCCCGCCGAGG - Exonic
1049539810 8:143203223-143203245 GCTCAGGGCTGTTGGTGCCGGGG - Intergenic
1053435005 9:38068719-38068741 GCGCAGGTCCCTCGGCGCCCCGG + Exonic
1055611822 9:78031737-78031759 GGACAGGGCCGAGGGCGCCCGGG - Intergenic
1057337353 9:94166348-94166370 GGAGAGGGCCGTCGCGGCCGTGG - Intergenic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1061149021 9:128818590-128818612 GCACAGGGCTGCTGGGGCCGCGG - Exonic
1061957351 9:133970519-133970541 CCACAGGGCTGTGGGTGCCGTGG - Intronic
1203731926 Un_GL000216v2:98947-98969 GCACAGGTCCTGCGGGGCCGCGG + Intergenic
1189446241 X:41084695-41084717 GCGCTGGGCGGTCGCCGCCGCGG - Intergenic
1195803178 X:108735177-108735199 CCTCAGGGCCATCGGCGACGGGG - Exonic
1199772639 X:150984152-150984174 GCCCCGGGCCGCGGGCGCCGGGG - Intronic