ID: 918064412

View in Genome Browser
Species Human (GRCh38)
Location 1:181089577-181089599
Sequence CGGCGGCCCAGCGGGCTGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 246}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918064399_918064412 7 Left 918064399 1:181089547-181089569 CCCCAGGAAGCGCTGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064397_918064412 17 Left 918064397 1:181089537-181089559 CCGCGGTGTGCCCCAGGAAGCGC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064401_918064412 6 Left 918064401 1:181089548-181089570 CCCAGGAAGCGCTGCGCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064391_918064412 28 Left 918064391 1:181089526-181089548 CCCCGCGCCGCCCGCGGTGTGCC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064392_918064412 27 Left 918064392 1:181089527-181089549 CCCGCGCCGCCCGCGGTGTGCCC 0: 1
1: 0
2: 2
3: 11
4: 239
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064396_918064412 18 Left 918064396 1:181089536-181089558 CCCGCGGTGTGCCCCAGGAAGCG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064390_918064412 29 Left 918064390 1:181089525-181089547 CCCCCGCGCCGCCCGCGGTGTGC 0: 1
1: 1
2: 1
3: 12
4: 149
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064403_918064412 5 Left 918064403 1:181089549-181089571 CCAGGAAGCGCTGCGCGGCGGGG 0: 1
1: 0
2: 6
3: 22
4: 187
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064389_918064412 30 Left 918064389 1:181089524-181089546 CCCCCCGCGCCGCCCGCGGTGTG 0: 1
1: 0
2: 2
3: 12
4: 167
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064393_918064412 26 Left 918064393 1:181089528-181089550 CCGCGCCGCCCGCGGTGTGCCCC 0: 1
1: 0
2: 3
3: 18
4: 188
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064395_918064412 21 Left 918064395 1:181089533-181089555 CCGCCCGCGGTGTGCCCCAGGAA 0: 1
1: 0
2: 0
3: 13
4: 87
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918064412 Original CRISPR CGGCGGCCCAGCGGGCTGCC CGG Exonic
900100804 1:961200-961222 CTGGGTCCCCGCGGGCTGCCCGG + Intronic
900123528 1:1059512-1059534 CGGGGGTCCCGCGGGCAGCCGGG - Intergenic
900290833 1:1922935-1922957 GGGAGGCCGAGGGGGCTGCCTGG + Intronic
900315336 1:2053489-2053511 GGGCGGCCCAGCTGGCTGCTGGG + Intronic
901007918 1:6180521-6180543 CGACGGCCGAGCGGGCAGTCGGG + Intergenic
901019763 1:6249708-6249730 GGGCGGCGGCGCGGGCTGCCGGG + Exonic
901157451 1:7150066-7150088 CGGTCGCCCAGCGGCCTCCCTGG + Intronic
901506540 1:9689303-9689325 CGGAGGCCCAGGACGCTGCCAGG - Intronic
901667728 1:10835998-10836020 CGCCGGCCCAGCGGCCTCCAGGG + Intergenic
901836316 1:11926203-11926225 CAGCGGCTCAAGGGGCTGCCGGG - Exonic
902042861 1:13505299-13505321 CTGCGGCTCAGGGGGCTACCGGG + Intronic
902476734 1:16692457-16692479 CGGCGGGCCGGCGGGCGGGCGGG + Intergenic
902477629 1:16696680-16696702 CAGCGGCCAATCGGGCTGCAGGG + Intergenic
903174862 1:21574845-21574867 CGGTGGCCCGGCAGGCTGGCAGG - Intronic
903294634 1:22335907-22335929 CTGCGGCCCTGCTGGGTGCCAGG + Intergenic
903440616 1:23385314-23385336 CAGCAGCCCAGCAGTCTGCCAGG + Intronic
903860107 1:26360013-26360035 CGGAGGCCCGGGGGCCTGCCTGG - Intergenic
905390583 1:37633620-37633642 TGGCCGCCCAGCAGGCTGGCAGG + Intronic
908511736 1:64854941-64854963 CCGTGGCACAGGGGGCTGCCTGG - Intronic
910193872 1:84621115-84621137 GGGCGGCCGAGCGGGCGGGCAGG + Intergenic
912670514 1:111620075-111620097 CGGCGGCCCGGGGGCCTGGCCGG + Intronic
915246278 1:154558448-154558470 GGGCGGCCCAGGGGGGGGCCCGG - Exonic
915646698 1:157277629-157277651 CCGCGGCCCAGTGGCCTGCAGGG + Intergenic
916043692 1:160982333-160982355 GGGCGGCACAGCAGGCTTCCTGG + Intergenic
916722510 1:167495035-167495057 TGGTGGCCCAGGTGGCTGCCTGG + Intronic
917920256 1:179744311-179744333 CCGCGGCCCAGAGGGGGGCCTGG + Intronic
918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG + Exonic
922729672 1:227942999-227943021 CTGGGGCACAGCTGGCTGCCTGG - Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923130540 1:231071122-231071144 TGACAGCCCAGCAGGCTGCCTGG - Intergenic
923490399 1:234478851-234478873 CGGACGCCCCGCGGGCGGCCCGG - Exonic
923792137 1:237120835-237120857 CTGTGGCCCCGCTGGCTGCCAGG + Intronic
924179238 1:241424345-241424367 CGGGGACCCAGCCGGCGGCCAGG + Intergenic
924483152 1:244454413-244454435 ATGCTGCCCAGCGGGCTGCATGG - Intronic
924740669 1:246792787-246792809 CGGCGGCCCTGGGGGGTGCACGG + Intergenic
1063224793 10:4005458-4005480 CAGCTGCACAGTGGGCTGCCGGG - Intergenic
1068637382 10:59362649-59362671 CCGCAGCCTCGCGGGCTGCCGGG - Intronic
1068783327 10:60944282-60944304 CGGCGGCGGAGCGAGGTGCCGGG - Intronic
1072637223 10:97185796-97185818 CGGCGCCCCTGCGGGCTGGGAGG + Exonic
1074399043 10:113126741-113126763 CGGCGGCGGCGCGGGCTGCAGGG + Intronic
1074865525 10:117542498-117542520 CTGCCGCCCACCGGGCGGCCGGG - Exonic
1075119337 10:119652240-119652262 CGGAGGCCGAGCGGGCAGCAGGG - Intronic
1075871239 10:125773858-125773880 CCGCGGCCCCGGGGGCGGCCAGG + Exonic
1075877910 10:125823151-125823173 CCGCGGCCCCTCGGGCTGCGTGG - Exonic
1077161301 11:1113794-1113816 CGGCTGCCCACCTGGCTGGCGGG - Intergenic
1077299613 11:1840946-1840968 CGGTGGCCCAGCGGGCAGGCGGG + Intronic
1077544948 11:3165184-3165206 CGGCGGCCCGGGGGGCGGCAGGG - Intronic
1083820209 11:65166184-65166206 CTGAGGCCCAAGGGGCTGCCTGG - Intergenic
1084128770 11:67118448-67118470 CGGCGGCGCCGGGGCCTGCCCGG + Intergenic
1084145233 11:67261659-67261681 CGGGGCCCCAGCGAGCTGCCAGG - Intergenic
1084385721 11:68841717-68841739 GGGCGGCCCTGCGGGCTGCGGGG - Intronic
1085518286 11:77123799-77123821 CGGCAGCCCAGCAACCTGCCAGG + Exonic
1086961343 11:92982386-92982408 GTGTGGCCCAGCAGGCTGCCTGG - Exonic
1087138152 11:94740634-94740656 CCGCGGCCCAGCGCCCGGCCGGG + Intronic
1087241715 11:95789156-95789178 AGGCGGCCCAGGAGGGTGCCGGG - Intronic
1088606798 11:111540783-111540805 CGGCGGTGGAGCGGGCTGGCGGG - Exonic
1089499060 11:118922241-118922263 CGGCGGCCCTGAAGGCTGCCTGG - Intronic
1090190396 11:124762772-124762794 CGCCGGCCGCGCGGGCTCCCTGG + Intergenic
1092123191 12:6058522-6058544 TGTGGGCCCAGCAGGCTGCCAGG + Intronic
1094041113 12:26122623-26122645 CGGCGGCCCGGGGGGCGGCGCGG - Exonic
1097830842 12:64222640-64222662 AGCCGGCCCAGCGAGGTGCCTGG - Intergenic
1102681329 12:114692509-114692531 GCGCGGCGCGGCGGGCTGCCCGG + Intergenic
1104833170 12:131768707-131768729 CGGCGTCCCGGGGGGCTGCTGGG - Intronic
1105605172 13:21920935-21920957 CGGCGGGGCAGCCGGCTGCCCGG + Intergenic
1106157487 13:27171758-27171780 CGGCGGCCCAGCGGGCTCGGTGG - Exonic
1108777399 13:53783629-53783651 CGCCAGCCCAGCGAGCTGCAGGG + Intergenic
1113527591 13:110992511-110992533 AGGTGGCCCAGGGGGCTCCCAGG - Intergenic
1113801934 13:113091243-113091265 GCGCGGCCCAGCTGGCTGTCAGG + Intronic
1113944390 13:114035653-114035675 CAGCGGCCCAGAGAGCAGCCAGG + Intronic
1113948156 13:114056486-114056508 CGGCGTCCCTGGGCGCTGCCCGG + Intronic
1113962344 13:114132817-114132839 AGGGACCCCAGCGGGCTGCCTGG + Intergenic
1119647831 14:76361198-76361220 CGGCTGCCCAGTGGCCTGGCAGG + Intronic
1119780018 14:77271151-77271173 CAGCGGCCAAGCGGGGTCCCCGG - Exonic
1121127560 14:91417850-91417872 CGGCGGCCCCGCGCCCCGCCCGG + Intergenic
1122047403 14:99034038-99034060 GTGGGGCCCAGCTGGCTGCCAGG + Intergenic
1122066182 14:99175721-99175743 CGGCGGCTCCGCGAGCTGGCGGG - Exonic
1122399457 14:101458400-101458422 GGGCGGGCCGGCGGGCTCCCGGG + Intergenic
1122582284 14:102778023-102778045 CCGCGGCCCCGCGGGGTGCCGGG - Intronic
1124427002 15:29570826-29570848 CGGCCTCCCAGCCGGCTGCCAGG + Intergenic
1126102856 15:45130029-45130051 CGCGGGCCCAGCTGGCAGCCAGG + Exonic
1126460895 15:48913748-48913770 AGGGGGCCCAGCGAGCTCCCAGG + Intronic
1128866002 15:71115607-71115629 CGGCGGCGCTCGGGGCTGCCCGG + Intronic
1129170737 15:73805982-73806004 CGGCAACCCGGCTGGCTGCCTGG + Intergenic
1129326465 15:74802605-74802627 CTGAGCCCCAGCGGGCTGGCGGG + Exonic
1129659927 15:77547919-77547941 TGGGGGCCCAGGGGGCTGCCTGG + Intergenic
1130076627 15:80695387-80695409 CGCCGGCCCGGCTGGCTGGCTGG - Exonic
1130564403 15:84981630-84981652 CGGCGGCCCAGCGGGCGGAGCGG + Intronic
1132365090 15:101251464-101251486 CGGCGGCCCGGCGGGCGGAGCGG - Exonic
1132402758 15:101523521-101523543 GGGTGGCCCAGCTGGCTGTCAGG - Intronic
1133156407 16:3879983-3880005 CGGGGGCCCTGCCGGCTGCGAGG + Exonic
1135712575 16:24729995-24730017 CGGAGGCCGAGCGGGCGGCCCGG + Intronic
1136403689 16:30031351-30031373 CGGTGGCACAGGGGGCTGCTGGG + Intronic
1137655263 16:50153569-50153591 CGGCGGCCCTGCGGGCGGCCGGG + Intronic
1139534505 16:67562956-67562978 CCGAGGCCTAGCGCGCTGCCAGG - Intronic
1140273027 16:73483239-73483261 CAGAGGTCCATCGGGCTGCCAGG + Intergenic
1141531262 16:84648539-84648561 TGGCTGCGCAGCGGGCTGGCCGG + Exonic
1141565695 16:84900114-84900136 CTGCGGCCAAGCGTTCTGCCTGG + Intronic
1141575113 16:84958705-84958727 CTGCGGCCCAGTGGGCTGGCGGG + Intergenic
1141633768 16:85303150-85303172 CGGAGGCCTAGTGGGGTGCCCGG + Intergenic
1141802249 16:86317963-86317985 CGGAGGTCCAGCCGGCTGCCTGG + Intergenic
1142990018 17:3724149-3724171 CGCCGCCTCACCGGGCTGCCGGG - Exonic
1143063325 17:4222102-4222124 CGGCGGTGCGGCGGGCGGCCAGG + Intronic
1143109395 17:4544930-4544952 CAGAGGCCCAGCGGTCAGCCAGG + Intronic
1143608291 17:8003269-8003291 CGGCGGCCAGGCGGGCGGCCAGG - Exonic
1144269218 17:13601205-13601227 CGGCGGGCCAGCGCGCTGGACGG + Exonic
1146926102 17:36746648-36746670 TGGGGTGCCAGCGGGCTGCCTGG + Intergenic
1147181012 17:38685748-38685770 GGCCAGCCAAGCGGGCTGCCCGG - Intergenic
1147340339 17:39750111-39750133 TGACGGCCCAGTGGGCAGCCTGG + Intergenic
1147612114 17:41807969-41807991 TGGCGGCGCTGCGGGCAGCCTGG + Exonic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148479493 17:47950666-47950688 GGGTGGCCCAGCAGCCTGCCAGG + Intergenic
1150549031 17:66192081-66192103 CGGCGACCCAGCGGCCCGCAAGG - Intronic
1151983201 17:77526376-77526398 GGGCTGCCCAGGGGGCTCCCCGG - Intergenic
1152301493 17:79497654-79497676 CAGCCCCCCAGCTGGCTGCCTGG + Intronic
1152635671 17:81429651-81429673 AGCAGGCACAGCGGGCTGCCTGG + Intronic
1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG + Intronic
1154285813 18:13055356-13055378 CGGCGGCTCAGCAGGCTGGCAGG - Intronic
1155096342 18:22559739-22559761 CAGCGACCCACCGGGCGGCCGGG + Intergenic
1155159179 18:23182007-23182029 CAGTGGCCCAGCGTGCAGCCAGG + Intronic
1155654543 18:28177889-28177911 CGGAGGCCGAGCGGGGTGCGCGG - Intergenic
1158976697 18:62716453-62716475 GGGCGGTTCAGCGGGCTCCCGGG - Exonic
1159040291 18:63318423-63318445 CGGCGGCGCCGGGGGCAGCCGGG + Exonic
1161210466 19:3062699-3062721 CCGAGGCCCGGCCGGCTGCCGGG - Exonic
1161313410 19:3607098-3607120 CAGCCGCCCAGCGCCCTGCCAGG + Intergenic
1161394423 19:4037689-4037711 CGGCGGCCCGGTGGGCAGCATGG + Exonic
1161779205 19:6279913-6279935 TGGCGGGCGAGCGGGCGGCCGGG - Exonic
1161902120 19:7126633-7126655 CAGCGGCCCATCTGGCTGCCTGG + Exonic
1162036631 19:7943622-7943644 CGGCGGCCCTGCGGAGTGGCTGG - Exonic
1162800071 19:13105300-13105322 ATGTGGCCCAGCGGGCTGCCCGG - Exonic
1163153258 19:15427182-15427204 GAGTGGCCCAGGGGGCTGCCCGG + Exonic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
1165721263 19:38081604-38081626 TGGCGCCACAGCTGGCTGCCAGG - Exonic
1166229113 19:41415255-41415277 CGGGGGCCCAGCTTGCTGCCTGG - Intronic
1167286945 19:48603666-48603688 CGGTGGGCCAGCGGGCCGTCAGG + Exonic
1167299414 19:48670482-48670504 GGGCGGCACAGCGGGCAGCGTGG + Exonic
1167627836 19:50604303-50604325 CGGCGGGTCCGCGGGCTGGCGGG + Intergenic
1167628193 19:50606198-50606220 CGGCGGGCCCGCGGGCTGGCGGG + Intergenic
1168356132 19:55701062-55701084 CGGGGGCCCTGAGGGCTCCCTGG + Intronic
925155342 2:1644669-1644691 GTGGGGCCCAGCCGGCTGCCAGG + Exonic
927204638 2:20599358-20599380 CGCTGTCCCAGCGAGCTGCCTGG + Intronic
927714425 2:25342521-25342543 CGGGGGCTCCGCGGGCTGCGGGG - Exonic
928440013 2:31284518-31284540 CAGAGGCCCAGAGAGCTGCCTGG + Intergenic
930089460 2:47521169-47521191 CGGCGGCGCAGCCGGGAGCCTGG + Exonic
930358213 2:50346856-50346878 CGGCGGCGCAGGGGGGCGCCTGG - Intronic
930711896 2:54557888-54557910 CGGCGGCCCGGCGAGCCACCGGG - Intronic
932599239 2:73112680-73112702 CTGCGGGCCCGCGGGCTGCGGGG - Exonic
936091645 2:109505228-109505250 TGGCGGCCCAGCCCTCTGCCAGG - Intergenic
938422436 2:131155574-131155596 CTGCGGCCCTGCGGCCGGCCCGG + Intronic
938795864 2:134718302-134718324 CTGCGGCTCCGCCGGCTGCCTGG - Intronic
946340038 2:219060777-219060799 CGGCGGGGCTGCGGGCCGCCGGG + Intergenic
947623486 2:231605080-231605102 CGGCGGGCCAGGGGCCTCCCAGG - Intergenic
948163488 2:235843870-235843892 TGGCGGCCCAGGAGGCTGCCTGG - Intronic
1171012795 20:21517626-21517648 CGCAGGCCCAGCTGGCGGCCAGG + Intergenic
1172118628 20:32585209-32585231 GGGCCGCCCCGCGGGCGGCCGGG + Intronic
1173704264 20:45098536-45098558 AGGCGGCCCAGCCGCGTGCCCGG + Exonic
1174449199 20:50609371-50609393 AGGTGGCTCAGCTGGCTGCCTGG + Intronic
1175913775 20:62416353-62416375 CGGCGCCCCTGCTGCCTGCCAGG - Intronic
1176382581 21:6120656-6120678 CGGCGGCGCAGCCGGCAGCCGGG + Exonic
1178882723 21:36461720-36461742 CGAGGGCCCAGGGAGCTGCCCGG - Exonic
1179185503 21:39082774-39082796 CGGCAGCCCAGCCAGGTGCCGGG - Intergenic
1179729461 21:43359574-43359596 CGTCGGGCCAGGGGGCTGCTGGG - Intergenic
1179740888 21:43417583-43417605 CGGCGGCGCAGCCGGCAGCCGGG - Exonic
1179933908 21:44590762-44590784 CAGGGGCCCAGAGTGCTGCCAGG + Intronic
1179940985 21:44638777-44638799 CAGGGGCCCAGAGTGCTGCCAGG - Intronic
1180189557 21:46155922-46155944 CGCAGGCCCCACGGGCTGCCTGG - Intergenic
1180614766 22:17120221-17120243 CGGCGGCGCGGGGGGCGGCCTGG - Exonic
1181039468 22:20184985-20185007 CGGAGGCCCAGGGCGCTGCAAGG - Intergenic
1182123248 22:27800114-27800136 CGGCGGCGCAGCCGGAGGCCTGG - Exonic
1182485541 22:30636553-30636575 CGGAGGGCCTGAGGGCTGCCAGG - Exonic
1182705163 22:32272380-32272402 CTGCGGGCCAGCGAGCTGACGGG + Intergenic
1183191105 22:36322551-36322573 CGGCAGCCCAGGTCGCTGCCCGG - Intronic
1183437704 22:37804994-37805016 GGCCGGGCCAGCGGGCCGCCCGG + Intergenic
1183508396 22:38221696-38221718 TGGGGGCACAGCGGCCTGCCGGG + Exonic
1183804027 22:40193049-40193071 CGGCGCCCCAGCGGTCAGCTTGG + Intronic
1184176369 22:42791843-42791865 CCGCGGACCTGCTGGCTGCCAGG - Intergenic
1184415586 22:44350173-44350195 CAGCAGCCCAGCCAGCTGCCCGG + Intergenic
1184642841 22:45881353-45881375 CGGCTGGCCAGCGGGGTGCTGGG - Intergenic
1184671049 22:46012520-46012542 CGGGGGCCCATGTGGCTGCCGGG - Intergenic
1184682721 22:46080533-46080555 CCGCCGGCCAGCAGGCTGCCCGG - Intronic
1185131394 22:49041105-49041127 CTGCTGCCCAGAGGGCTGCAAGG + Intergenic
1185333286 22:50261057-50261079 CGGCCCCACAGCAGGCTGCCTGG + Intronic
955368771 3:58333093-58333115 GCGCGGCCCAGCGGGCGGGCGGG + Intronic
959575404 3:107927939-107927961 CTGCAGCCTCGCGGGCTGCCCGG + Intergenic
961141892 3:124562942-124562964 GAGCGGCCCAGCGAGCGGCCTGG + Intronic
961167475 3:124773608-124773630 AGCCGGCCCTGAGGGCTGCCTGG + Intronic
962343469 3:134603659-134603681 CTGCAGCACAGCTGGCTGCCAGG - Exonic
966449001 3:180036760-180036782 CGGCAGCGCTGCGGGCTGCCGGG + Exonic
968547560 4:1206599-1206621 CGGGGACCCAGCGGGCTGAGTGG + Intronic
968606199 4:1536831-1536853 CGGGGACCCAGGGGCCTGCCTGG + Intergenic
968803194 4:2756303-2756325 CGGCGGCCGCGCGGCCTCCCGGG - Exonic
969288849 4:6225863-6225885 CGGTGGCCCAGCAGGCTGGCTGG - Intergenic
969362610 4:6674258-6674280 GCGGGGCTCAGCGGGCTGCCCGG - Intergenic
969619108 4:8270018-8270040 CGGCGCCGCAGGGGGCTCCCGGG - Exonic
969647479 4:8440948-8440970 CGGCGCTCCAGCGGGCCTCCAGG - Exonic
970332793 4:15002880-15002902 CGGCGGCGGCGCGGGCAGCCCGG + Exonic
973707043 4:53591457-53591479 CGGCGGCCCAAGGAGCTGCTCGG - Exonic
973718756 4:53702748-53702770 CGGCTGCCCAGCTGTCTGCGTGG - Intronic
979349367 4:119627702-119627724 CGGCTGCGCAGCGGGCAGTCGGG - Intronic
982712259 4:158769150-158769172 CGGCGGCTCAGCGCGCAGCCGGG - Exonic
985016340 4:185639103-185639125 CGCAGGCACAGCGCGCTGCCAGG - Intronic
985656772 5:1135958-1135980 CGTCGGCCCTGCGGGGTGCAGGG + Intergenic
985660744 5:1155604-1155626 CGGCGGCCTGGCGGGCCGGCGGG - Intergenic
985784576 5:1887083-1887105 CGGAGCCCTCGCGGGCTGCCGGG - Exonic
987776317 5:22372323-22372345 CAGCTGCCAAGCAGGCTGCCTGG - Intronic
992190615 5:74288021-74288043 CGGGGGGTCAGGGGGCTGCCTGG - Intergenic
992716273 5:79514123-79514145 CGGCGGCAGAGTGGGCTGCGGGG + Exonic
994760315 5:103843813-103843835 CTGCGGCCCACCCTGCTGCCTGG - Intergenic
997727426 5:136133158-136133180 CGGAGGCCTCGCTGGCTGCCCGG + Intronic
997870133 5:137499102-137499124 CGGCCGCCTAGGGGGCTGGCAGG - Intronic
998193007 5:140042823-140042845 CGGCGGCTCTCCGGGCTGCGGGG + Exonic
1001573775 5:172748535-172748557 GGGCTGCCCGGCTGGCTGCCGGG - Intergenic
1003600409 6:7511862-7511884 AGGCGCCCCAGTGAGCTGCCAGG - Intergenic
1004441923 6:15662553-15662575 CGGCGGCGCAGCGGAGCGCCCGG - Intronic
1004923859 6:20401518-20401540 CGCCGGCCCGGCGGGCGGGCGGG + Intergenic
1006119339 6:31794944-31794966 GGGGGGCCCAGGGGGCAGCCGGG - Exonic
1007262342 6:40572564-40572586 CACCAGCCCAGCAGGCTGCCTGG + Intronic
1007371152 6:41427757-41427779 AGGCGGCCGACCCGGCTGCCAGG + Intergenic
1007781589 6:44257580-44257602 CGGCGGCCCGGGGCGCTGCGTGG - Intronic
1008545073 6:52576993-52577015 CGGCGGGCCGGCGGGCGGACCGG - Intergenic
1009209368 6:60843798-60843820 CTGCCACCCAGCGGGCTGCAGGG + Intergenic
1015904874 6:138107072-138107094 CCGCGGCCCCGAGGGCTTCCTGG + Intronic
1017672208 6:156778592-156778614 CGGCGGCCCGGCGGCCGTCCCGG + Exonic
1018756047 6:166850698-166850720 TGGCGGCTCAGCGGGAAGCCAGG + Intronic
1018928656 6:168224548-168224570 CGGTGACCCAGCAGGCAGCCAGG + Intergenic
1018959907 6:168441020-168441042 CTGCGGCCCAGAGGCCTCCCTGG - Intergenic
1019348293 7:541270-541292 GGGGGGCTCAGCGGGCTCCCTGG - Intergenic
1019348319 7:541335-541357 GGGGGGCTCAGCGGGCTCCCTGG - Intergenic
1019348351 7:541411-541433 AGGGGGCTCAGCGGGCTCCCTGG - Intergenic
1019523513 7:1470797-1470819 CGGCCTCCCCGAGGGCTGCCAGG + Intronic
1019666951 7:2256782-2256804 CGGCCGGCCACCGCGCTGCCGGG + Intronic
1019711814 7:2521313-2521335 CAGGGGCTCAGCGGGCTGGCGGG + Intronic
1019777162 7:2918638-2918660 CTGCGGCCCCGCTGGCTTCCCGG - Intronic
1020003222 7:4767349-4767371 CCTCGGCCCTGCGGGCGGCCTGG + Exonic
1020049609 7:5072839-5072861 CAGAGGACCAGGGGGCTGCCTGG + Intronic
1020282137 7:6655020-6655042 AGGTGGGCCAGCGGGATGCCTGG + Exonic
1024393718 7:48843116-48843138 CGGCAGACCCGCGTGCTGCCGGG + Intergenic
1024401533 7:48929299-48929321 CGGCAGACCCGCGTGCTGCCGGG - Intergenic
1026471054 7:70694410-70694432 CAGCCGCGCCGCGGGCTGCCTGG - Intronic
1026828507 7:73597763-73597785 GGGAGGCCCAGATGGCTGCCAGG - Intronic
1026877149 7:73886400-73886422 CAGAGGCCCAGAGGGCTGTCTGG + Intergenic
1029115148 7:98232911-98232933 CGCCGGCCCAGACCGCTGCCTGG - Exonic
1030156329 7:106459670-106459692 TGGCTGCCCAACCGGCTGCCTGG + Intergenic
1032090309 7:128908534-128908556 CTGCTGCCCAGGGGGCTCCCTGG + Exonic
1033200006 7:139360237-139360259 CGGCGGCGTAGCGGGCGGACGGG - Exonic
1034963087 7:155374352-155374374 GGGCGGCCCGGCGGGCGGGCCGG + Intergenic
1037815078 8:22107840-22107862 CGGAGTCCCTGCAGGCTGCCTGG - Exonic
1038554191 8:28494780-28494802 CGGCGGCAGCGCGGGGTGCCGGG + Intronic
1038798154 8:30727569-30727591 GGGCGGCCGAGCTGGGTGCCAGG - Exonic
1040558878 8:48506175-48506197 CCGCGGCCCTGACGGCTGCCTGG - Intergenic
1042591588 8:70403009-70403031 CCGCGGCCCGGCGGGTGGCCCGG - Intronic
1043436534 8:80240765-80240787 CATCGGCCCAGGGTGCTGCCTGG + Intergenic
1049212263 8:141392195-141392217 CGGCGGCCCTCCCGGCTGCGCGG - Intronic
1049218344 8:141417828-141417850 CGGCGGGCGACCCGGCTGCCGGG - Intronic
1049531799 8:143158971-143158993 GGGGGGCGCAGGGGGCTGCCTGG - Intronic
1049591609 8:143465335-143465357 CTGCAGCCCTGCGGGCTCCCTGG + Intronic
1049755267 8:144308755-144308777 GGGAGGCCCAGGGGGCTGGCGGG - Intronic
1049773518 8:144394518-144394540 CTGCGGGCCAGCGAGCTGACGGG - Exonic
1051404943 9:16727117-16727139 CGGCGGGCCGGCGGGCGGGCGGG + Intronic
1056143559 9:83707637-83707659 CGGCGGTCCTCCGGGCTCCCAGG - Exonic
1057478728 9:95427069-95427091 CGCCGGCCCAAGGGGCAGCCAGG + Intergenic
1057869712 9:98708696-98708718 CGGCGGCGGCCCGGGCTGCCCGG + Exonic
1059380458 9:113919588-113919610 AGCCGGCCCAGGGGCCTGCCAGG - Intronic
1060811664 9:126614051-126614073 GGGCGGCCCCGCGGGCCGCGGGG - Intergenic
1061072933 9:128322886-128322908 CGTCGGCTCTGCGGGCTCCCGGG + Exonic
1061262646 9:129488569-129488591 CGGCGGCCTGGCGGGCGGCCCGG - Intergenic
1061853349 9:133428807-133428829 TGGCGGCCCAGCGGGCTGGCTGG - Intronic
1061853397 9:133428963-133428985 GGGCGGCCCAGCGGGCTGGCTGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062537717 9:137028201-137028223 CAGCGGCGCGGCGGGCTGCGGGG - Intronic
1062595717 9:137298254-137298276 CAGCTGCCCACAGGGCTGCCCGG + Intergenic
1185446076 X:258588-258610 TGGGGGCCCAGCTGGGTGCCCGG - Intergenic
1187419473 X:19122309-19122331 CGGCGGGCCAGCGGGCCGGCGGG - Intronic
1189104330 X:38220817-38220839 CGGCAGCGCAGCGCGCTTCCCGG + Exonic
1189375444 X:40462980-40463002 CTGCTGTCCAGCGGGCTGCCTGG - Intergenic
1189418242 X:40833145-40833167 CGGCGGCCGTGCGGCCTCCCAGG - Intergenic
1190108500 X:47574713-47574735 CGGGGGCCCTGCGGGCTGCTGGG + Exonic
1195072095 X:101291194-101291216 GGGCGGCCGACCGGGCGGCCGGG - Intronic
1195363225 X:104104897-104104919 CGGCAGCCCAGCGGTGTCCCAGG + Exonic
1200090327 X:153632975-153632997 CAGGGACCCAGCGGGCTCCCTGG + Intergenic
1201304401 Y:12538141-12538163 GGGCTGCCCAGCGAGATGCCAGG + Intergenic