ID: 918064412

View in Genome Browser
Species Human (GRCh38)
Location 1:181089577-181089599
Sequence CGGCGGCCCAGCGGGCTGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 246}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918064397_918064412 17 Left 918064397 1:181089537-181089559 CCGCGGTGTGCCCCAGGAAGCGC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064393_918064412 26 Left 918064393 1:181089528-181089550 CCGCGCCGCCCGCGGTGTGCCCC 0: 1
1: 0
2: 3
3: 18
4: 188
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064403_918064412 5 Left 918064403 1:181089549-181089571 CCAGGAAGCGCTGCGCGGCGGGG 0: 1
1: 0
2: 6
3: 22
4: 187
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064392_918064412 27 Left 918064392 1:181089527-181089549 CCCGCGCCGCCCGCGGTGTGCCC 0: 1
1: 0
2: 2
3: 11
4: 239
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064401_918064412 6 Left 918064401 1:181089548-181089570 CCCAGGAAGCGCTGCGCGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064395_918064412 21 Left 918064395 1:181089533-181089555 CCGCCCGCGGTGTGCCCCAGGAA 0: 1
1: 0
2: 0
3: 13
4: 87
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064391_918064412 28 Left 918064391 1:181089526-181089548 CCCCGCGCCGCCCGCGGTGTGCC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064389_918064412 30 Left 918064389 1:181089524-181089546 CCCCCCGCGCCGCCCGCGGTGTG 0: 1
1: 0
2: 2
3: 12
4: 167
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064396_918064412 18 Left 918064396 1:181089536-181089558 CCCGCGGTGTGCCCCAGGAAGCG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064399_918064412 7 Left 918064399 1:181089547-181089569 CCCCAGGAAGCGCTGCGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246
918064390_918064412 29 Left 918064390 1:181089525-181089547 CCCCCGCGCCGCCCGCGGTGTGC 0: 1
1: 1
2: 1
3: 12
4: 149
Right 918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG 0: 1
1: 0
2: 3
3: 30
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918064412 Original CRISPR CGGCGGCCCAGCGGGCTGCC CGG Exonic