ID: 918069511

View in Genome Browser
Species Human (GRCh38)
Location 1:181124592-181124614
Sequence CAGAAGGAGGAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918069511_918069518 -7 Left 918069511 1:181124592-181124614 CCTCCCTCCTCCTCCTCCTTCTG No data
Right 918069518 1:181124608-181124630 CCTTCTGCTTTGTTTTCTTCTGG No data
918069511_918069520 -1 Left 918069511 1:181124592-181124614 CCTCCCTCCTCCTCCTCCTTCTG No data
Right 918069520 1:181124614-181124636 GCTTTGTTTTCTTCTGGAGGAGG No data
918069511_918069519 -4 Left 918069511 1:181124592-181124614 CCTCCCTCCTCCTCCTCCTTCTG No data
Right 918069519 1:181124611-181124633 TCTGCTTTGTTTTCTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918069511 Original CRISPR CAGAAGGAGGAGGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr