ID: 918071733

View in Genome Browser
Species Human (GRCh38)
Location 1:181138226-181138248
Sequence TCCAGGATGGACATGCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918071730_918071733 -10 Left 918071730 1:181138213-181138235 CCTGGAGTCAGTGTCCAGGATGG No data
Right 918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG No data
918071727_918071733 -4 Left 918071727 1:181138207-181138229 CCAATCCCTGGAGTCAGTGTCCA No data
Right 918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG No data
918071729_918071733 -9 Left 918071729 1:181138212-181138234 CCCTGGAGTCAGTGTCCAGGATG No data
Right 918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG No data
918071726_918071733 -3 Left 918071726 1:181138206-181138228 CCCAATCCCTGGAGTCAGTGTCC No data
Right 918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG No data
918071724_918071733 30 Left 918071724 1:181138173-181138195 CCTGCTGGGTTTGGTGAGGATGA No data
Right 918071733 1:181138226-181138248 TCCAGGATGGACATGCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918071733 Original CRISPR TCCAGGATGGACATGCCATT GGG Intergenic
No off target data available for this crispr