ID: 918071946

View in Genome Browser
Species Human (GRCh38)
Location 1:181139686-181139708
Sequence CATGCTGCAGAGGTGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918071935_918071946 24 Left 918071935 1:181139639-181139661 CCAGGTGCCTCCTGCGGGGCATA No data
Right 918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG No data
918071939_918071946 14 Left 918071939 1:181139649-181139671 CCTGCGGGGCATAAGGAGGCTGG No data
Right 918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG No data
918071934_918071946 25 Left 918071934 1:181139638-181139660 CCCAGGTGCCTCCTGCGGGGCAT No data
Right 918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG No data
918071938_918071946 17 Left 918071938 1:181139646-181139668 CCTCCTGCGGGGCATAAGGAGGC No data
Right 918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918071946 Original CRISPR CATGCTGCAGAGGTGGGCCT AGG Intergenic
No off target data available for this crispr