ID: 918072435

View in Genome Browser
Species Human (GRCh38)
Location 1:181142686-181142708
Sequence GCCTCCACACCCAGCGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918072435_918072438 -1 Left 918072435 1:181142686-181142708 CCCGCTCCGCTGGGTGTGGAGGC No data
Right 918072438 1:181142708-181142730 CTCAGCCTGTCCCACACAAATGG No data
918072435_918072439 0 Left 918072435 1:181142686-181142708 CCCGCTCCGCTGGGTGTGGAGGC No data
Right 918072439 1:181142709-181142731 TCAGCCTGTCCCACACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918072435 Original CRISPR GCCTCCACACCCAGCGGAGC GGG (reversed) Intergenic
No off target data available for this crispr