ID: 918072483

View in Genome Browser
Species Human (GRCh38)
Location 1:181143092-181143114
Sequence CAGCAGATGTCACAGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918072483_918072492 16 Left 918072483 1:181143092-181143114 CCAGGCCTCTGTGACATCTGCTG No data
Right 918072492 1:181143131-181143153 TAAGAGATCATCGTCCTGCCTGG No data
918072483_918072493 19 Left 918072483 1:181143092-181143114 CCAGGCCTCTGTGACATCTGCTG No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918072483 Original CRISPR CAGCAGATGTCACAGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr