ID: 918072493

View in Genome Browser
Species Human (GRCh38)
Location 1:181143134-181143156
Sequence GAGATCATCGTCCTGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918072482_918072493 20 Left 918072482 1:181143091-181143113 CCCAGGCCTCTGTGACATCTGCT No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072481_918072493 21 Left 918072481 1:181143090-181143112 CCCCAGGCCTCTGTGACATCTGC No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072487_918072493 -9 Left 918072487 1:181143120-181143142 CCACCCCACCATAAGAGATCATC No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072483_918072493 19 Left 918072483 1:181143092-181143114 CCAGGCCTCTGTGACATCTGCTG No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072484_918072493 14 Left 918072484 1:181143097-181143119 CCTCTGTGACATCTGCTGTCCCG No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072486_918072493 -6 Left 918072486 1:181143117-181143139 CCGCCACCCCACCATAAGAGATC No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data
918072485_918072493 -5 Left 918072485 1:181143116-181143138 CCCGCCACCCCACCATAAGAGAT No data
Right 918072493 1:181143134-181143156 GAGATCATCGTCCTGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918072493 Original CRISPR GAGATCATCGTCCTGCCTGG AGG Intergenic
No off target data available for this crispr