ID: 918074946

View in Genome Browser
Species Human (GRCh38)
Location 1:181162950-181162972
Sequence CAGCTGTGTGTACCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918074942_918074946 -10 Left 918074942 1:181162937-181162959 CCTCCCTGTCAAACAGCTGTGTG No data
Right 918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG No data
918074941_918074946 -7 Left 918074941 1:181162934-181162956 CCTCCTCCCTGTCAAACAGCTGT No data
Right 918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG No data
918074940_918074946 -4 Left 918074940 1:181162931-181162953 CCACCTCCTCCCTGTCAAACAGC No data
Right 918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG No data
918074939_918074946 16 Left 918074939 1:181162911-181162933 CCTCTGAATTAGAATGCTGTCCA No data
Right 918074946 1:181162950-181162972 CAGCTGTGTGTACCTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918074946 Original CRISPR CAGCTGTGTGTACCTGGCTC AGG Intergenic
No off target data available for this crispr