ID: 918075283

View in Genome Browser
Species Human (GRCh38)
Location 1:181166299-181166321
Sequence CTATTGGAACAGCAGGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918075275_918075283 7 Left 918075275 1:181166269-181166291 CCTGGAAGGTGTTTGTGTCCCCC No data
Right 918075283 1:181166299-181166321 CTATTGGAACAGCAGGCCCGCGG No data
918075274_918075283 15 Left 918075274 1:181166261-181166283 CCATTGTGCCTGGAAGGTGTTTG No data
Right 918075283 1:181166299-181166321 CTATTGGAACAGCAGGCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918075283 Original CRISPR CTATTGGAACAGCAGGCCCG CGG Intergenic
No off target data available for this crispr