ID: 918075334

View in Genome Browser
Species Human (GRCh38)
Location 1:181166676-181166698
Sequence CCACATGCAGAGCCACTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918075334_918075341 6 Left 918075334 1:181166676-181166698 CCCTGTAGTGGCTCTGCATGTGG No data
Right 918075341 1:181166705-181166727 CGGAGTGTCTTCACAGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918075334 Original CRISPR CCACATGCAGAGCCACTACA GGG (reversed) Intergenic
No off target data available for this crispr