ID: 918081805

View in Genome Browser
Species Human (GRCh38)
Location 1:181213614-181213636
Sequence CTGTGGTCTGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918081799_918081805 13 Left 918081799 1:181213578-181213600 CCATGTAGAAGTGGGCTGTGCTA No data
Right 918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG No data
918081798_918081805 14 Left 918081798 1:181213577-181213599 CCCATGTAGAAGTGGGCTGTGCT No data
Right 918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918081805 Original CRISPR CTGTGGTCTGAGAGGGAAGA AGG Intergenic
No off target data available for this crispr