ID: 918083776

View in Genome Browser
Species Human (GRCh38)
Location 1:181227988-181228010
Sequence ATGAAGAAGGAGAAATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918083776_918083783 10 Left 918083776 1:181227988-181228010 CCATCCCATTTCTCCTTCTTCAT No data
Right 918083783 1:181228021-181228043 TGAAGTGCAGATGTGGTGGCAGG No data
918083776_918083781 3 Left 918083776 1:181227988-181228010 CCATCCCATTTCTCCTTCTTCAT No data
Right 918083781 1:181228014-181228036 TGTGGACTGAAGTGCAGATGTGG No data
918083776_918083782 6 Left 918083776 1:181227988-181228010 CCATCCCATTTCTCCTTCTTCAT No data
Right 918083782 1:181228017-181228039 GGACTGAAGTGCAGATGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918083776 Original CRISPR ATGAAGAAGGAGAAATGGGA TGG (reversed) Intergenic
No off target data available for this crispr