ID: 918092550

View in Genome Browser
Species Human (GRCh38)
Location 1:181310044-181310066
Sequence AAGCCCATGCTGTATCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918092550_918092554 26 Left 918092550 1:181310044-181310066 CCTCTAGGATACAGCATGGGCTT No data
Right 918092554 1:181310093-181310115 TTTTTTTTTTTTTTTTAAGATGG 0: 1944
1: 89534
2: 65843
3: 89503
4: 176988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918092550 Original CRISPR AAGCCCATGCTGTATCCTAG AGG (reversed) Intergenic
No off target data available for this crispr