ID: 918094202

View in Genome Browser
Species Human (GRCh38)
Location 1:181321284-181321306
Sequence CTAGGTTGCCAGGCAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918094202_918094204 -10 Left 918094202 1:181321284-181321306 CCACTTTTTGCCTGGCAACCTAG No data
Right 918094204 1:181321297-181321319 GGCAACCTAGATCTCACCACAGG No data
918094202_918094205 -9 Left 918094202 1:181321284-181321306 CCACTTTTTGCCTGGCAACCTAG No data
Right 918094205 1:181321298-181321320 GCAACCTAGATCTCACCACAGGG No data
918094202_918094207 4 Left 918094202 1:181321284-181321306 CCACTTTTTGCCTGGCAACCTAG No data
Right 918094207 1:181321311-181321333 CACCACAGGGATCTCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918094202 Original CRISPR CTAGGTTGCCAGGCAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr