ID: 918096686

View in Genome Browser
Species Human (GRCh38)
Location 1:181341902-181341924
Sequence GTGAACAAGATAAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918096682_918096686 -2 Left 918096682 1:181341881-181341903 CCAGGTGCTGAGAATGCAGCAGT No data
Right 918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918096686 Original CRISPR GTGAACAAGATAAAGGTGGG AGG Intergenic
No off target data available for this crispr