ID: 918098878

View in Genome Browser
Species Human (GRCh38)
Location 1:181356594-181356616
Sequence TCTTCTCCCTGAAGGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918098878_918098885 16 Left 918098878 1:181356594-181356616 CCAGCAGGCCTTCAGGGAGAAGA No data
Right 918098885 1:181356633-181356655 GAAGGGCACTTAGGCTCTTCAGG No data
918098878_918098884 7 Left 918098878 1:181356594-181356616 CCAGCAGGCCTTCAGGGAGAAGA No data
Right 918098884 1:181356624-181356646 GTCTGCTCTGAAGGGCACTTAGG No data
918098878_918098881 -2 Left 918098878 1:181356594-181356616 CCAGCAGGCCTTCAGGGAGAAGA No data
Right 918098881 1:181356615-181356637 GAGAGCCAGGTCTGCTCTGAAGG No data
918098878_918098882 -1 Left 918098878 1:181356594-181356616 CCAGCAGGCCTTCAGGGAGAAGA No data
Right 918098882 1:181356616-181356638 AGAGCCAGGTCTGCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918098878 Original CRISPR TCTTCTCCCTGAAGGCCTGC TGG (reversed) Intergenic