ID: 918099865

View in Genome Browser
Species Human (GRCh38)
Location 1:181364043-181364065
Sequence GCCTAGCCTGACTTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918099865_918099870 7 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099870 1:181364073-181364095 TCCCATTAGGGCCTTTGTAATGG No data
918099865_918099874 25 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data
918099865_918099866 -6 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099866 1:181364060-181364082 CTAGGCATGCCCTTCCCATTAGG No data
918099865_918099867 -5 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099867 1:181364061-181364083 TAGGCATGCCCTTCCCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918099865 Original CRISPR GCCTAGCCTGACTTGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr