ID: 918099870

View in Genome Browser
Species Human (GRCh38)
Location 1:181364073-181364095
Sequence TCCCATTAGGGCCTTTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918099865_918099870 7 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099870 1:181364073-181364095 TCCCATTAGGGCCTTTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918099870 Original CRISPR TCCCATTAGGGCCTTTGTAA TGG Intergenic
No off target data available for this crispr