ID: 918099874

View in Genome Browser
Species Human (GRCh38)
Location 1:181364091-181364113
Sequence AATGGCTGTTCCAGATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918099869_918099874 -2 Left 918099869 1:181364070-181364092 CCTTCCCATTAGGGCCTTTGTAA No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data
918099871_918099874 -6 Left 918099871 1:181364074-181364096 CCCATTAGGGCCTTTGTAATGGC No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data
918099868_918099874 -1 Left 918099868 1:181364069-181364091 CCCTTCCCATTAGGGCCTTTGTA No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data
918099865_918099874 25 Left 918099865 1:181364043-181364065 CCTGGAGGCAAGTCAGGCTAGGC No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data
918099872_918099874 -7 Left 918099872 1:181364075-181364097 CCATTAGGGCCTTTGTAATGGCT No data
Right 918099874 1:181364091-181364113 AATGGCTGTTCCAGATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918099874 Original CRISPR AATGGCTGTTCCAGATTGCC TGG Intergenic
No off target data available for this crispr