ID: 918102425

View in Genome Browser
Species Human (GRCh38)
Location 1:181387884-181387906
Sequence CTATTGCAACACATTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918102423_918102425 -8 Left 918102423 1:181387869-181387891 CCTCAGGACCTCTAACTATTGCA No data
Right 918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG No data
918102420_918102425 1 Left 918102420 1:181387860-181387882 CCCTCCTGACCTCAGGACCTCTA No data
Right 918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG No data
918102418_918102425 14 Left 918102418 1:181387847-181387869 CCATATGAGGCTGCCCTCCTGAC No data
Right 918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG No data
918102421_918102425 0 Left 918102421 1:181387861-181387883 CCTCCTGACCTCAGGACCTCTAA No data
Right 918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG No data
918102422_918102425 -3 Left 918102422 1:181387864-181387886 CCTGACCTCAGGACCTCTAACTA No data
Right 918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918102425 Original CRISPR CTATTGCAACACATTTCCCT AGG Intergenic
No off target data available for this crispr