ID: 918103912

View in Genome Browser
Species Human (GRCh38)
Location 1:181400376-181400398
Sequence TATGTGGCCTGACGTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918103907_918103912 -9 Left 918103907 1:181400362-181400384 CCTTTCCTGAAGTTTATGTGGCC No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data
918103904_918103912 -5 Left 918103904 1:181400358-181400380 CCCTCCTTTCCTGAAGTTTATGT No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data
918103905_918103912 -6 Left 918103905 1:181400359-181400381 CCTCCTTTCCTGAAGTTTATGTG No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data
918103901_918103912 28 Left 918103901 1:181400325-181400347 CCTTTGATGTATATACAGTCAGC No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data
918103903_918103912 -4 Left 918103903 1:181400357-181400379 CCCCTCCTTTCCTGAAGTTTATG No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data
918103902_918103912 3 Left 918103902 1:181400350-181400372 CCTGCTACCCCTCCTTTCCTGAA No data
Right 918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918103912 Original CRISPR TATGTGGCCTGACGTTGGGG TGG Intergenic
No off target data available for this crispr