ID: 918106337

View in Genome Browser
Species Human (GRCh38)
Location 1:181418434-181418456
Sequence GAGCACTAGGAAGTAAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918106337_918106339 -1 Left 918106337 1:181418434-181418456 CCAGTGCTTACTTCCTAGTGCTC 0: 1
1: 0
2: 2
3: 8
4: 130
Right 918106339 1:181418456-181418478 CTTGCCCAGTCCCAGACCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918106337 Original CRISPR GAGCACTAGGAAGTAAGCAC TGG (reversed) Intronic
901521274 1:9786943-9786965 GAACACTAAGAAGGAAGCAAGGG + Intronic
902186659 1:14730582-14730604 CAGAACTAGGATGCAAGCACAGG + Intronic
904305390 1:29585532-29585554 GAGCACCAGGAAGCAGGCAGCGG - Intergenic
910393403 1:86767679-86767701 AAGCACAAGGAAGAAAGCAAAGG + Intergenic
910967026 1:92818177-92818199 TAAAACCAGGAAGTAAGCACAGG - Intergenic
914843788 1:151269123-151269145 GGGAATAAGGAAGTAAGCACAGG - Intergenic
915018984 1:152761755-152761777 GAGTTCTAGGAAGTCGGCACAGG - Exonic
916257013 1:162799041-162799063 GAGCACTAGCCAGTATGCATTGG - Intronic
918106337 1:181418434-181418456 GAGCACTAGGAAGTAAGCACTGG - Intronic
918374784 1:183898088-183898110 AACTAGTAGGAAGTAAGCACTGG + Intronic
920531923 1:206708310-206708332 GAGGAATAGGAAGTAACAACAGG - Intronic
920825198 1:209418426-209418448 GAGCACTGGGATGAAAGCCCAGG + Intergenic
924732226 1:246722814-246722836 GGGCACTAGGAATAAAGTACTGG - Intergenic
1063508588 10:6624620-6624642 GAGCACAAGGGAGACAGCACAGG + Intergenic
1063830547 10:9947420-9947442 GGGCTTTAAGAAGTAAGCACTGG - Intergenic
1064939579 10:20718488-20718510 GAAAACCAGGAAGTAGGCACTGG - Intergenic
1066723475 10:38364733-38364755 GAGCACTAGCCAGTATGCATTGG - Intergenic
1068370292 10:56104065-56104087 GAGCAGGAGGAAGAAAGCAGTGG - Intergenic
1069010118 10:63363205-63363227 GAGAAGTATGAAGAAAGCACTGG + Intronic
1072042793 10:91625447-91625469 TATCATTAGGAAGTTAGCACAGG + Intergenic
1072128400 10:92468134-92468156 GAGAAGTAGGATGTAGGCACTGG + Intronic
1074397748 10:113112578-113112600 AAACACTATTAAGTAAGCACGGG - Intronic
1077900765 11:6486328-6486350 GAGGACTGGGAAATAACCACCGG - Intronic
1078008025 11:7547243-7547265 GACAACTAGGAAGTGAGCTCAGG + Intronic
1084422778 11:69068750-69068772 GAGTCCTAGGAAGTGACCACAGG + Intronic
1084422833 11:69069062-69069084 GAGTCCTAGGAAGTGACCACAGG + Intronic
1084557517 11:69883760-69883782 GAGCCCAAGGAAGGAAGCTCAGG + Intergenic
1085949078 11:81307606-81307628 GAGCACTAGCAAATAAGGAGAGG - Intergenic
1087251302 11:95903379-95903401 AAGTACTATGAAGTAAGCAAGGG - Intronic
1088156811 11:106815584-106815606 GAGCACCAGGAAGGAAGAAAAGG + Intronic
1088420074 11:109635882-109635904 GAACACTAGGGTGTAAGGACTGG + Intergenic
1099982572 12:89623688-89623710 GAGCACTGAGAGGTAAGCAAAGG + Intronic
1100177013 12:92042398-92042420 AAGCACTAGTAAGTAAGGAGAGG + Intronic
1100818343 12:98407372-98407394 CAGAACTAGGTAGTAAGCACTGG + Intergenic
1104740880 12:131172824-131172846 AAGGAGAAGGAAGTAAGCACAGG + Intergenic
1106000758 13:25720730-25720752 AAGCATCAGGAAGTAAGAACTGG - Intronic
1106658579 13:31774430-31774452 GAGTACTATGAGGAAAGCACTGG + Intronic
1115836784 14:37414803-37414825 AAGTACTAGGAAACAAGCACAGG + Intronic
1117187019 14:53250147-53250169 CAACACTTGGAAGGAAGCACTGG - Intergenic
1121321714 14:92995334-92995356 GCTCACTAGGAAGGCAGCACTGG - Intronic
1124222215 15:27860883-27860905 GAGCAGTAAGAAGTAAGCTCAGG + Intronic
1128103723 15:65028070-65028092 GGGCACTATAAAGAAAGCACAGG + Intronic
1128358687 15:66945589-66945611 CAGCACTGGGAAGCAGGCACAGG + Intergenic
1129143397 15:73623929-73623951 GAGCACAGGGAAGAAAGCATAGG - Intronic
1129659046 15:77542921-77542943 GAGCTCTAGGAGGCAAGCCCGGG - Intergenic
1129664750 15:77573302-77573324 CAGCACAAGGAGGGAAGCACAGG + Intergenic
1132286192 15:100664489-100664511 TAGCACTGGGAAGGAAGAACAGG - Intergenic
1135772634 16:25228917-25228939 GAGCACGTGGAAGGAAACACTGG - Exonic
1141299340 16:82798879-82798901 GAACCCTTGGAAGTGAGCACAGG + Intronic
1146373034 17:32277010-32277032 GAGCCCTGGGAAATGAGCACAGG - Intronic
1151478198 17:74355399-74355421 GATGACCAGGAAGTAAGCTCAGG + Exonic
1152973976 18:195508-195530 GATCACTAGGAAGTCCGCAGAGG + Intronic
1153642141 18:7166305-7166327 GAGCACAAGGAGGTGAGGACAGG - Intergenic
1155528866 18:26745404-26745426 GAGAACAAGGAAGCAGGCACTGG + Intergenic
1157965905 18:52207842-52207864 GAGAAATCAGAAGTAAGCACAGG - Intergenic
1158121477 18:54053073-54053095 AAACACAAGGAAGTAAGCAGAGG + Intergenic
1159136488 18:64342994-64343016 GGGCACTAGGAAATAACCATTGG + Intergenic
1162356191 19:10186482-10186504 AAGCACTAGGAAGGAATCATAGG - Intronic
1163110365 19:15157022-15157044 GAGGACTAGGAAGCCTGCACTGG - Intergenic
1167535914 19:50051262-50051284 GAGCACAAGGAAGGAAAAACCGG + Intronic
925796939 2:7555613-7555635 GATTAATTGGAAGTAAGCACAGG - Intergenic
926522428 2:13931826-13931848 GAGTACTAGGAAGAAAACAGTGG - Intergenic
927153271 2:20207808-20207830 GAGCTCTGGGAAGGCAGCACAGG - Intronic
927375153 2:22404709-22404731 GAGCACTGAAAAGTCAGCACAGG + Intergenic
942498555 2:176564448-176564470 GAGCACAAGGAGGAAAGCACAGG - Intergenic
946607788 2:221424836-221424858 GGGCACCAGGCAGCAAGCACAGG - Intronic
946734594 2:222741710-222741732 CAGTACCAGGAAGTAAACACTGG - Intergenic
1168948235 20:1778856-1778878 GAGGAATAGGAAGTAAGACCTGG + Intergenic
1169664093 20:8015288-8015310 AAGCATTTGGAAGTATGCACAGG + Intronic
1169729265 20:8768592-8768614 CAGCACTGTGAAGTAAGTACAGG + Intronic
1169797384 20:9478260-9478282 GACTACCAGGAAGTAAGCAATGG - Intronic
1172060207 20:32182234-32182256 GAGCAAGAGCAAGCAAGCACTGG + Intergenic
1172807109 20:37619965-37619987 GAGCACTAGAAAGCCAGCATAGG + Intergenic
1173710455 20:45151154-45151176 CAGCACTAGGAGGTAAAAACAGG - Intergenic
1176304001 21:5114073-5114095 GAACACCAGGAAGGAAGAACAGG + Intergenic
1177781195 21:25624046-25624068 GAGCACAAGGAAAGAAGCAGAGG - Intergenic
1179853029 21:44147877-44147899 GAACACCAGGAAGGAAGAACAGG - Intergenic
1185149715 22:49157165-49157187 GCGCACTTGGAAGTGGGCACTGG + Intergenic
953721816 3:45362917-45362939 AAGCACTGGGAAGTAACCAGTGG + Intergenic
955537520 3:59940037-59940059 CAGGACTAGGAATTAAGCCCAGG - Intronic
955595815 3:60589204-60589226 AAGCACAAGGTAATAAGCACAGG + Intronic
959571834 3:107893135-107893157 CAGCACTGGGAAGAGAGCACTGG + Intergenic
960127987 3:114021683-114021705 GAGCATCAGGAAGTAAGCTGGGG - Intronic
960869874 3:122238116-122238138 GAGCAATATGAAATTAGCACCGG - Intronic
961150826 3:124636534-124636556 GAACACTAGGAAGTAATAAAAGG - Intronic
962165442 3:133042792-133042814 GAGGACTAGGATGCAAGCTCAGG + Intronic
962450922 3:135516365-135516387 GAGCAAGAGGAAGTGAGCAAGGG - Intergenic
964587545 3:158323746-158323768 GAGCATTAGGAAATAACCAAAGG - Intronic
968619078 4:1595538-1595560 GAGCCCTGGGAAGTCACCACTGG + Intergenic
970173840 4:13316766-13316788 TAGCACTATGAAGAAAACACAGG - Intergenic
974485921 4:62505929-62505951 GAACACTAGGAAGAAAGAAAAGG - Intergenic
977420600 4:96795173-96795195 GTGCACTAGGAGGTGAGCAGCGG - Intergenic
980783740 4:137525661-137525683 GAGCACCAGGAAGTCACCAATGG - Intronic
980909179 4:138978374-138978396 GAGCTCTAGGAAGCAGGGACTGG - Intergenic
986523638 5:8649183-8649205 GAGGACAGGGAAGTAACCACTGG - Intergenic
989373482 5:40734465-40734487 TAGCACAAGGAAGGAAGCAAAGG + Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993863310 5:93162220-93162242 GAGCAAGAGGAAATTAGCACAGG - Intergenic
994867796 5:105300016-105300038 TAGCTATAGGATGTAAGCACTGG + Intergenic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
995700613 5:114930686-114930708 GAGCACTAGTGAGCAAGCTCAGG - Intergenic
995931747 5:117454883-117454905 TGGCACTAGTAAGTAAGAACTGG + Intergenic
997752059 5:136356237-136356259 CTGCACTAGGAAATAACCACAGG + Intronic
1002108119 5:176890267-176890289 GAGCACTACGGAGGAAGCACTGG - Intronic
1002420898 5:179148650-179148672 GAGGACCAGGAAGGAAGCACGGG - Intronic
1004549474 6:16632622-16632644 GAGCACTATAAACTTAGCACTGG - Intronic
1006007120 6:31011348-31011370 GGGCACTAGGGAGGAAGGACGGG - Intronic
1007032168 6:38638894-38638916 GAGCACTGAGAAGACAGCACAGG + Intronic
1012899058 6:104986138-104986160 GAGCACGAGGAAGAGAGCAAAGG - Intronic
1013106461 6:107030065-107030087 GGGCACTAGGAATTCAGCAGAGG - Intronic
1016653063 6:146485120-146485142 GAGCACTAGGCAGGAAGGGCAGG - Intergenic
1020944694 7:14587980-14588002 AAGCACTAGGAAGTACGTACAGG - Intronic
1023994202 7:45148982-45149004 GTGCAATATGAAGTCAGCACTGG + Intergenic
1026477594 7:70750211-70750233 GAGGAATAGGAAGTGGGCACAGG + Intronic
1026826847 7:73587786-73587808 TAGCACTATGAAGCAGGCACTGG + Intergenic
1027276217 7:76559706-76559728 GATCACTTGAAAGTAAGGACAGG - Intergenic
1032740156 7:134730455-134730477 GAGCATTAGGAACTATCCACGGG + Intergenic
1035615978 8:1002177-1002199 GAGCACCAGGAAGGAATCCCAGG - Intergenic
1037272032 8:17140993-17141015 GAGTACTGGGAAGTAAACAGAGG + Intergenic
1037356618 8:18026814-18026836 GAGAACCAGGAAGAAAGCAGAGG - Intronic
1040009455 8:42649120-42649142 GAGCAGTAGGAATTAAGCTTTGG - Intergenic
1042201601 8:66284200-66284222 CAGCACCAGGAAGTGAGGACAGG + Intergenic
1042525122 8:69756739-69756761 GAGCACTAGGAAGCAAACACAGG + Intronic
1042950950 8:74200240-74200262 CAGCACTAGGAAGTATGAGCTGG - Intergenic
1042967025 8:74364631-74364653 GAGCAATAGAAAGTAAGCTTCGG + Exonic
1045751800 8:105494082-105494104 GATCACCAGGAAGCATGCACAGG - Intronic
1046742858 8:117846969-117846991 GAGCAATAGAGAGTTAGCACAGG - Intronic
1047173713 8:122520401-122520423 CATGACTAGCAAGTAAGCACAGG - Intergenic
1047651732 8:126930321-126930343 GATCTCTAAGAAGTGAGCACAGG + Intergenic
1047703521 8:127473738-127473760 GAGCACTTAGAAGCAAGCATGGG - Intergenic
1049662682 8:143827163-143827185 CAGCACTACGAAGAAAGCACAGG + Intronic
1050369662 9:4908068-4908090 GATCTCTATGAAGTAAGAACAGG + Intergenic
1053480204 9:38410946-38410968 GAGCCCCAGGAAGGAAGCTCAGG + Intronic
1059662116 9:116412102-116412124 GAGCACTTGAAATTCAGCACTGG + Intergenic
1060077053 9:120601223-120601245 CAGCCCTAGAAAGTAAGCCCAGG - Exonic
1061014191 9:127972517-127972539 GAGCACCAGGAGGCAGGCACCGG + Intronic
1186096036 X:6103089-6103111 GAGCAGTAGAAAGCAACCACAGG - Intronic
1190489827 X:50970321-50970343 GAGCAGTAGGAAGTGGGCATAGG + Intergenic
1194386462 X:93261628-93261650 GAGCACAAGGAAGTAGGCACAGG - Intergenic
1197424594 X:126280094-126280116 GAGCACTAGAAAGTAGGTACAGG - Intergenic
1198596445 X:138241101-138241123 GAGAAGTAGTAAGTAAGTACAGG - Intergenic